Previous Contig 012890:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033F04Sequence709012890 (2)gb:AY085368_15704391e-18Arabidopsis thaliana clone 14816 mRNA, complete sequence.>gb:BT002825_1636418 Ar658012890 (2)gb:AY085368_15704391e-09Arabidopsis thaliana clone 14816 mRNA, complete sequence.>gb:BT002825_1636418 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033F04- GAACATTCAAATCCCATCCACTAACATATTCTCC
                      ____________________________________________________________
consensus GAACATTCAAATCCCATCCACTAACATATTCTCC
 
. : . : . : . : . : . :
JMSF033F04- GATTGGCCAGCCATGGATGTATCTGACTACACCTACTTGACGACCAGGAAGAGGCATGTC
                      ____________________________________________________________
consensus GATTGGCCAGCCATGGATGTATCTGACTACACCTACTTGACGACCAGGAAGAGGCATGTC
 
. : . : . : . : . : . :
JMSF033F04- CCGGCGTTTGGGAACTGGGACTGTAACCAAGACTTCCCCATCCCCTTCACCCAGTGCTTC
                      ____________________________________________________________
consensus CCGGCGTTTGGGAACTGGGACTGTAACCAAGACTTCCCCATCCCCTTCACCCAGTGCTTC
 
. : . : . : . : . : . :
JMSF033F04- GAATCCGCCACCCAGGCCGGCCTGCTCCCGGGGGATTTGTACGTCGCCGGCGATCTCTAC
rJMSF033F04+ ATCCGCCACCCAGGCCGGCCTGCTCCCGGGGGATTTGTACGTCGCCGGCGATCTCTAC
                      ____________________________________________________________
consensus GAATCCGCCACCCAGGCCGGCCTGCTCCCGGGGGATTTGTACGTCGCCGGCGATCTCTAC
 
. : . : . : . : . : . :
JMSF033F04- GACAACCATATCCTCACTCCGGCCATGATTGTCGTCCCCCGCCGTAAGGGAAAAGCCCAA
rJMSF033F04+ GACAACCATATCCTCACTCCGGCCATGATTGTCGTCCCCCGCCGTAAGGGAAAAGCCCAA
                      ____________________________________________________________
consensus GACAACCATATCCTCACTCCGGCCATGATTGTCGTCCCCCGCCGTAAGGGAAAAGCCCAA
 
. : . : . : . : . : . :
JMSF033F04- TCGTACAACAATGTAGGCGGCGGCGGCGGCGGCGGAGGGAAAGGCCTAGAGGGAAGAAAA
rJMSF033F04+ TCGTACAACAATGTAGGCGGCGGCGGCGGCGGCGGAGGGAAAGGCCTAGAGGGAAGAAAA
                      ____________________________________________________________
consensus TCGTACAACAATGTAGGCGGCGGCGGCGGCGGCGGAGGGAAAGGCCTAGAGGGAAGAAAA
 
. : . : . : . : . : . :
JMSF033F04- GATGCATGGGTGGTCTGCGACTGCGACTGCGATAACGCGCCGCCGCCTCCTCCTCCTCCG
rJMSF033F04+ GATGCATGGGTGGTCTGCGACTGCGACTGCGATAACGCGCCGCCGCCTCCTCCTCCTCCG
                      ____________________________________________________________
consensus GATGCATGGGTGGTCTGCGACTGCGACTGCGATAACGCGCCGCCGCCTCCTCCTCCTCCG
 
. : . : . : . : . : . :
JMSF033F04- CCCAAACGCGCACCTAAGGCCGTCGACGAAGATCTCTACAAGATTTCTCCCGACCTCCTC
rJMSF033F04+ CCCAAACGCGCACCTAAGGCCGTCGACGAAGATCTCTACAAGATTTCTCCCGACCTCCTC
                      ____________________________________________________________
consensus CCCAAACGCGCACCTAAGGCCGTCGACGAAGATCTCTACAAGATTTCTCCCGACCTCCTC
 
. : . : . : . : . : . :
JMSF033F04- TACTCTAAACCCAAACAGAGGAGGGTATGGGGATTTCTGTTAAGTTGCCTGCGACCTTGT
rJMSF033F04+ TACTCTAAACCCAAACAGAGGAGGGTATGGGGATTTCTGTTAAGTTGCCTGCGACCTTGT
                      ____________________________________________________________
consensus TACTCTAAACCCAAACAGAGGAGGGTATGGGGATTTCTGTTAAGTTGCCTGCGACCTTGT
 
. : . : . : . : . : . :
JMSF033F04- TCTTGTGCATGATGAAGCAGAAGGGGTGGTGGGGTGAAAGAGATGTACAGTTTCAAGAAT
rJMSF033F04+ TCTTGTGCATGATGAAGCAGAAGGGGTGGTGGGGTGAAAGAGATGTACAGTTTCAAGAAT
                      ____________________________________________________________
consensus TCTTGTGCATGATGAAGCAGAAGGGGTGGTGGGGTGAAAGAGATGTACAGTTTCAAGAAT
 
. : . : . : . : . : . :
JMSF033F04- TTATGGGGGAAACCAGACAGGATGGTTTATCATCATTATTAAAATGATGATGGGCATAAT
rJMSF033F04+ TTATGGGGGAAACCAGACAGGATGGTTTATCATCATTATTAAAATGATGATGGGCATAAT
                      ____________________________________________________________
consensus TTATGGGGGAAACCAGACAGGATGGTTTATCATCATTATTAAAATGATGATGGGCATAAT
 
. : . : . : . : . : . :
JMSF033F04- GATGGTGTGATGGATTCAAAAGTGTGTAATTTTTGTTGGAAGTTGATACTAATGTTTTGC
rJMSF033F04+ GATGGTGTGATGGATTCAAAAGTGTGTAATTTTTGTTGGAAGTTGATACTAATGTTTTGC
                      ____________________________________________________________
consensus GATGGTGTGATGGATTCAAAAGTGTGTAATTTTTGTTGGAAGTTGATACTAATGTTTTGC
 
. : . : . : . : . : . :
JMSF033F04- CCAGTTACCTTA
rJMSF033F04+ CCAGTTACCTTAGTTATAATATATATATATATGGGTATCTCAGTATGTAGTAGTAATGTG
                      ____________________________________________________________
consensus CCAGTTACCTTAGTTATAATATATATATATATGGGTATCTCAGTATGTAGTAGTAATGTG
 
. : . : . : . : . : . :
rJMSF033F04+ AGAGAGAGAGAGAGAAAGGAACAGTTTGGGGGGTGAATGTAGCAGAGAAAAGTTGATGGT
                      ____________________________________________________________
consensus AGAGAGAGAGAGAGAAAGGAACAGTTTGGGGGGTGAATGTAGCAGAGAAAAGTTGATGGT