Previous Contig 012888:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033E03Sequence679012888 (2)gb:AY088087_15731111e-04Arabidopsis thaliana clone 41104 mRNA, complete sequence.>gb:BT006199_1639091 Ar754012888 (2)pir|T47337|T473372e-32nucleic acid binding protein-like - Arabidopsis thaliana>gb:ATT21C14_1555104 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033E03- GGTTTATTTCCACTCGTTTAATC
                      ____________________________________________________________
consensus GGTTTATTTCCACTCGTTTAATC
 
. : . : . : . : . : . :
JMSF033E03- GTCTCTGCAATCTATACCTTTGTTTTAATTGATGCCTTTGGATTTAGTCAATTCTTTTCG
                      ____________________________________________________________
consensus GTCTCTGCAATCTATACCTTTGTTTTAATTGATGCCTTTGGATTTAGTCAATTCTTTTCG
 
. : . : . : . : . : . :
JMSF033E03- CAATTGCCCAGTTGCAGAGGCCTTGCTGCCTTTGTACTTAGATGAAGCTGATTTCAGAAT
                      ____________________________________________________________
consensus CAATTGCCCAGTTGCAGAGGCCTTGCTGCCTTTGTACTTAGATGAAGCTGATTTCAGAAT
 
. : . : . : . : . : . :
JMSF033E03- TTCATTCCATAAATTCGTCTATAATGTTTGTTATTTGTGCATTCAGTGCTTGCTGCTCTA
                      ____________________________________________________________
consensus TTCATTCCATAAATTCGTCTATAATGTTTGTTATTTGTGCATTCAGTGCTTGCTGCTCTA
 
. : . : . : . : . : . :
JMSF033E03- GATTCAGAGACATCACTTGTCATGTTGAGACCTAGAAATTAGTTTGATATCAAATGTAGG
rJMSF033E03+ GAGACCTAGAAATTAGTTTGATATCAAATGTAGG
                      ____________________________________________________________
consensus GATTCAGAGACATCACTTGTCATGTTGAGACCTAGAAATTAGTTTGATATCAAATGTAGG
 
. : . : . : . : . : . :
JMSF033E03- AAGGTTATTGCCATTTTATATTCTCATTCCAATTGGGTTCCAAGAGGACAGAAGATTGGT
rJMSF033E03+ AAGGTTATTGCCATTTTATATTCTCATTCCAATTGGGTTCCAAGAGGACAGAAGATTGGT
                      ____________________________________________________________
consensus AAGGTTATTGCCATTTTATATTCTCATTCCAATTGGGTTCCAAGAGGACAGAAGATTGGT
 
. : . : . : . : . : . :
JMSF033E03- GTCTAAGATTCATTTTTCTTTTTAGTTGAATAAGTGAATAACTCTCTATCCATTGATGGT
rJMSF033E03+ GTCTAAGATTCATTTTTCTTTTTAGTTGAATAAGTGAATAACTCTCTATCCATTGATGGT
                      ____________________________________________________________
consensus GTCTAAGATTCATTTTTCTTTTTAGTTGAATAAGTGAATAACTCTCTATCCATTGATGGT
 
. : . : . : . : . : . :
JMSF033E03- TCTTTATTCAAAAGTTAGTAAGTTAATTTTAGCAGTATTCAAGCATCTTGAAATCATTTT
rJMSF033E03+ TCTTTATTCAAAAGTTAGTAAGTTAATTTTAGCAGTATTCAAGCATCTTGAAATCATTTT
                      ____________________________________________________________
consensus TCTTTATTCAAAAGTTAGTAAGTTAATTTTAGCAGTATTCAAGCATCTTGAAATCATTTT
 
. : . : . : . : . : . :
JMSF033E03- ATTGCATGTGCAGGAAGGTTCTGTTCAACATGATAAATGAGCTGCCTACAGTATTTGAGA
rJMSF033E03+ ATTGCATGTGCAGGAAGGTTCTGTTCAACATGATAAATGAGCTGCCTACAGTATTTGAGA
                      ____________________________________________________________
consensus ATTGCATGTGCAGGAAGGTTCTGTTCAACATGATAAATGAGCTGCCTACAGTATTTGAGA
 
. : . : . : . : . : . :
JMSF033E03- TTGT
rJMSF033E03+ TTGTGACTGGTGCTGCAAAGAAACATAACGAGAAATCTGTAATCACAAATCATGGTGGCA
                      ____________________________________________________________
consensus TTGTGACTGGTGCTGCAAAGAAACATAACGAGAAATCTGTAATCACAAATCATGGTGGCA
 
. : . : . : . : . : . :
rJMSF033E03+ GCAAAATGAAGTCAAGCTCCAAATCGCGACCAGCTGAATCTCATGGAAGGGCGATGAATG
                      ____________________________________________________________
consensus GCAAAATGAAGTCAAGCTCCAAATCGCGACCAGCTGAATCTCATGGAAGGGCGATGAATG
 
. : . : . : . : . : . :
rJMSF033E03+ TGAACCCCCACTATGAAGAGGAGGAATACTATGATGAAGAGGAGCATGGTAACACCTTGT
                      ____________________________________________________________
consensus TGAACCCCCACTATGAAGAGGAGGAATACTATGATGAAGAGGAGCATGGTAACACCTTGT
 
. : . : . : . : . : . :
rJMSF033E03+ GCGGTGCTTGTGGGAAGCACGGTGGATTGGATGAATTCTGGATTGGCTGTGACAAATGCG
                      ____________________________________________________________
consensus GCGGTGCTTGTGGGAAGCACGGTGGATTGGATGAATTCTGGATTGGCTGTGACAAATGCG
 
. : . : . : . : . : . :
rJMSF033E03+ AAAGGTGGTTCCATGGCAGGTGCGTGAAAGTCACCCCTGCCAAAGCCGAGCACATGAAGC
                      ____________________________________________________________
consensus AAAGGTGGTTCCATGGCAGGTGCGTGAAAGTCACCCCTGCCAAAGCCGAGCACATGAAGC
 
. : . : . : . : . : . :
rJMSF033E03+ ACTACAAGTGTCCCTCTTGCAGCAGCAAGAGAATCCGTCCCTGAGGTAGAAATATGTTGT
                      ____________________________________________________________
consensus ACTACAAGTGTCCCTCTTGCAGCAGCAAGAGAATCCGTCCCTGAGGTAGAAATATGTTGT
 
. : . : . : . : . : . :
rJMSF033E03+ GTTACTTAACTCTTGCTGAGAAACAAAACTTTAGGCCGCTGTGCTTATTAACTTTGAACA
                      ____________________________________________________________
consensus GTTACTTAACTCTTGCTGAGAAACAAAACTTTAGGCCGCTGTGCTTATTAACTTTGAACA
 
. : . : . : . : . : . :
rJMSF033E03+ TCATTTTATTTCTCTAGAATTCGACTCTTCATATCTTTGAATTATATCAGATATTATCTT
                      ____________________________________________________________
consensus TCATTTTATTTCTCTAGAATTCGACTCTTCATATCTTTGAATTATATCAGATATTATCTT