Previous Contig 012885:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K23Sequence473012885 (19)sp|O20252|S17P_SPIOL2e-31Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu783012885 (19)gb:AY188797_1588367e-124Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMFF007C24Sequence580012885 (19)sp|O20252|S17P_SPIOL1e-46Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu797012885 (19)gb:AY188797_1588367e-128Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMFF034F11Sequence572012885 (19)sp|O20252|S17P_SPIOL2e-51Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu636012885 (19)gb:AY188797_15883674e-97Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMFS058B09Sequence621012885 (19)sp|O20252|S17P_SPIOL2e-62Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu
JMSF008E24Sequence355012885 (19)sp|O20252|S17P_SPIOL3e-17Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu742012885 (19)gb:AY188797_1588367e-122Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMSF018O02Sequence529012885 (19)gb:AY188797_15883671e-78Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMSF024H03Sequence670012885 (19)sp|O20252|S17P_SPIOL3e-53Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu737012885 (19)gb:AY188797_1588367e-104Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMSF026C15Sequence674012885 (19)sp|O20252|S17P_SPIOL5e-70Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu777012885 (19)gb:AY188797_1588367e-131Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMSF033C11Sequence672012885 (19)sp|O20252|S17P_SPIOL9e-54Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu760012885 (19)gb:AY188797_1588367e-122Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMSF042J05Sequence846012885 (19)sp|O20252|S17P_SPIOL5e-98Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu793012885 (19)gb:AY188797_1588367e-131Oryza sativa (indica cultivar-group) sedoheptulose-1,7-bisphosphatase precursor,
JMSF043J05Sequence152012885 (19)sp|O20252|S17P_SPIOL3e-17Sedoheptulose-1,7-bisphosphatase, chloroplast precursor (EC 3.1.3.37) (Sedoheptu

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024H03- GAGCCTATCTATAACACCACACGCCACGTGTCATAAATCCAAGCACCCGTTTATCTACTA
JMSF033C11- GAGCCTATCTATAACACCACACGCCACGTGTCATAAATCCAAGCACCCGTTTATCTACTA
                      ____________________________________________________________
consensus GAGCCTATCTATAACACCACACGCCACGTGTCATAAATCCAAGCACCCGTTTATCTACTA
 
. : . : . : . : . : . :
JMFF034F11- ACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
JMFF007C24- GCCTACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
JMFF005K23- GCCTACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
JMSF024H03- GCTTTGCAGCTCTCCATCCATGCTGCCTACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
JMSF033C11- GCTTTGCAGCTCTCCATCCATGCTGCCTACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
JMFS058B09- TGTTCCATGCCTAAGAAGTAAGA
JMSF026C15- GCCTACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
JMSF042J05- GCCTACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
                      ____________________________________________________________
consensus GCTTTGCAGCTCTCCATCCATGCTGCCTACTGGTGGCTGTTCCATGCCTAAGAAGTAAGA
 
. : . : . : . : . : . :
JMFF034F11- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMSF008E24- ATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMFF007C24- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMFF005K23- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMSF024H03- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMSF033C11- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMFS058B09- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMSF026C15- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
JMSF042J05- ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
                      ____________________________________________________________
consensus ATTGAATTGAAGCTTTCTTCCAATCTTCATTCTTTCCCCTCAAGTTCCAGCTTAGCTTGA
 
. : . : . : . : . : . :
JMFF034F11- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
JMSF008E24- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
JMFF007C24- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
JMFF005K23- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCTTC
JMSF024H03- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
JMSF033C11- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
JMFS058B09- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
JMSF026C15- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
JMSF042J05- ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
                      ____________________________________________________________
consensus ATCTCTACAATAGCCATGGAGACTGCAGGCATCACATGCTGCGCACGTGCAGCTCTCCTC
 
. : . : . : . : . : . :
JMFF034F11- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMSF008E24- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMFF007C24- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMFF005K23- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMSF024H03- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMSF033C11- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMFS058B09- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMSF026C15- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
JMSF042J05- CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
                      ____________________________________________________________
consensus CCAAACGTTGTTGTTTCTCCCCAACATTCAGCTGCTCTGGCTAGTCCGAGGTCCATTTCT
 
. : . : . : . : . : . :
JMFF034F11- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMSF008E24- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMFF007C24- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMFF005K23- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMSF024H03- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMSF033C11- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMFS058B09- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMSF026C15- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
JMSF042J05- GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
                      ____________________________________________________________
consensus GCATCATTCACCAACAAGGCTCTGAAACCAAGTTCATTATTCGGGGAATCATTGCGCTTT
 
. : . : . : . : . : . :
JMFF034F11- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMSF008E24- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMFF007C24- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMFF005K23- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMSF024H03- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMSF033C11- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMFS058B09- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMSF026C15- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
JMSF042J05- TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
                      ____________________________________________________________
consensus TCGCCTAAATCGACACAAAGGGTGTCAAGAAGAGCAAAGAACTCATCATCCCTTGTGGCC
 
. : . : . : . : . : . :
JMFF034F11- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
JMSF008E24- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAA
JMFF007C24- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
JMFF005K23- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
JMSF024H03- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
JMSF033C11- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
JMFS058B09- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
JMSF026C15- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
JMSF042J05- AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
                      ____________________________________________________________
consensus AAATGTGAGCTAGGTGACAGTCTGGAAGAATTTCTTACGAAATCGACTCAAGATAAGGGG
 
. : . : . : . : . : . :
JMFF034F11- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
JMFF007C24- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
JMFF005K23- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
JMSF024H03- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
JMSF033C11- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
JMFS058B09- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
JMSF026C15- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
JMSF042J05- CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
                      ____________________________________________________________
consensus CTGATCAGGCTAATGATGTGCATGGGAGAAGCTCTGAGAACAATTGCCTTCAAAGTCAGA
 
. : . : . : . : . : . :
JMFF034F11- ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATG-AACAGCTCGCAGT
JMFF007C24- ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATGAAACAGCTCGCAGT
JMFF005K23- ACAGCTTCCTGTGG
JMSF024H03- ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATG-AACAGCTCGCAGT
JMSF033C11- ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATG-AACAGCTCGCAGT
JMFS058B09- ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATG-AACAGCTCGCAGT
JMSF026C15- ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATG-AACAGCTCGCAGT
JMSF042J05- ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATG-AACAGCTCGCAGT
                      ____________________________________________________________
consensus ACAGCTTCCTGTGGAGGAACAGCCTGTGTCAATTCTTTCGGGGATG-AACAGCTCGCAGT
 
. : . : . : . : . : . :
JMFF034F11- TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
JMFF007C24- TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
JMSF024H03- TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
JMSF033C11- TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
JMFS058B09- TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
JMSF026C15- TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
JMSF042J05- TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
rJMSF026C15+ TGACTTACTCACATTTCTGCAAATA
rJMFF007C24+ AAATA
rJMSF042J05+ ACTTACTCACATTTCTGCAAATA
                      ____________________________________________________________
consensus TGATTTGCTTGCTAATAAGCTTCTCTTTGAGGCCTTGACTTACTCACATTTCTGCAAATA
 
. : . : . : . : . : . :
JMFF034F11- C
JMFF007C24- C
JMSF024H03- CGCTTGTTCAG
JMSF033C11- CGCTTGTTCAGAA
JMFS058B09- CGCTTGTTCAGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGAT
JMSF026C15- CGCTTGTTCAGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
JMSF042J05- CGCTTGTTCAGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
rJMSF026C15+ CGCNTGTTCAGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
rJMSF008E24+ CGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
rJMFF007C24+ CGCTTGTTCAGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
rJMSF043J05+ GATT
rJMFF005K23+ AGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
rJMSF042J05+ CGCTTGTTCAGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
rJMSF033C11+ CCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
                      ____________________________________________________________
consensus CGCTTGTTCAGAAGAAGTTCCCGAGCTGCAGGATATGGGAGGACCAGTTGAGGGTGGATT
 
. : . : . : . : . : . :
JMSF026C15- TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTG
JMSF042J05- TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
rJMSF026C15+ TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
rJMSF008E24+ TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
rJMFF007C24+ TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
rJMSF043J05+ TAGTGTTGCTTTTGATNCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
rJMFF005K23+ TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
rJMSF024H03+ AGTGGG
rJMSF042J05+ TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
rJMSF033C11+ TAGTGTTGCTTTTGATTCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
                      ____________________________________________________________
consensus TAGTGTTGCTTTTGATCCACTTGATGGTTCGAGTATTGTGGACACCAATTTCACAGTGGG
 
. : . : . : . : . : . :
JMSF042J05- AACCATTTTTGGCGTGTGGCCTGGGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
rJMSF026C15+ AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
rJMSF008E24+ AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
rJMFF007C24+ AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
rJMSF043J05+ ATCCATTTTTGGCGTGNGGCCN-GGGNATAAGCTATCCGGGGTTACAGGAAGGGATCAAG
rJMFF005K23+ AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
rJMSF024H03+ AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
rJMSF042J05+ AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
rJMFF034F11+ T-GGGGATAAGCTANCCGGGGTTACAGGAAGGGATCAAG
rJMSF033C11+ AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
                      ____________________________________________________________
consensus AACCATTTTTGGCGTGTGGCCT-GGGGATAAGCTAACCGGGGTTACAGGAAGGGATCAAG
 
. : . : . : . : . : . :
JMSF042J05- TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMSF026C15+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMSF018O02+ TAAAGATA
rJMSF008E24+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMFF007C24+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMSF043J05+ TTGCAGCTGCCATGGGAATATTCGGGCCT
rJMFF005K23+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMSF024H03+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMSF042J05+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMFF034F11+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
rJMSF033C11+ TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
                      ____________________________________________________________
consensus TTGCAGCTGCCATGGGAATATTCGGGCCTCGTACTACTTATGTTCTTGCTCTTAAAGATA
 
. : . : . : . : . : . :
JMSF042J05- TTCCTGGAACACATGAATTCCTCCTCC
rJMSF026C15+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMSF018O02+ TTCCTGGAACACATGAATTCCTCNTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMSF008E24+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMFF007C24+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMFF005K23+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMSF024H03+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMSF042J05+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMFF034F11+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
rJMSF033C11+ TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
                      ____________________________________________________________
consensus TTCCTGGAACACATGAATTCCTCCTCCTCGACGAAGGGAAATGGCAGCATGTCAAGGATA
 
. : . : . : . : . : . :
rJMSF026C15+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMSF018O02+ CAACCGAGATNGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMSF008E24+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMFF007C24+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMFF005K23+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMSF024H03+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMSF042J05+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMFF034F11+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
rJMSF033C11+ CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
                      ____________________________________________________________
consensus CAACCGAGATTGGAGAAGGGAAAATGTTCTCCCCAGGGAACCTCAGAGCCACGTCTGATA
 
. : . : . : . : . : . :
rJMSF026C15+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMSF018O02+ ATCCAGACTATGCTAAGNTGATAGACTANTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMSF008E24+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMFF007C24+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMFF005K23+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMSF024H03+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMSF042J05+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMFF034F11+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
rJMSF033C11+ ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
                      ____________________________________________________________
consensus ATCCTGACTATGCTAAGCTGATAGACTACTATGTCAGAGAGAAGTACACCCTGAGATACA
 
. : . : . : . : . : . :
rJMSF026C15+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMSF018O02+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMSF008E24+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMFF007C24+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMFF005K23+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMSF024H03+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMSF042J05+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMFF034F11+ CCGGAGGTATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
rJMSF033C11+ CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
                      ____________________________________________________________
consensus CCGGAGGAATGGTGCCCGATGTAAACCAGATCATTGTGAAGGAGAAGGGGATCTTCACAA
 
. : . : . : . : . : . :
rJMSF026C15+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMSF018O02+ ACGTGATATCCCCGTCNGCAAAGGCGAAGNTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMSF008E24+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMFF007C24+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMFF005K23+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMSF024H03+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMSF042J05+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMFF034F11+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
rJMSF033C11+ ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
                      ____________________________________________________________
consensus ACGTGATATCCCCGTCTGCAAAGGCGAAGCTGAGGCTGCTGTTCGAGGTGGCTCCTTTGG
 
. : . : . : . : . : . :
rJMSF026C15+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMSF018O02+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMSF008E24+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMFF007C24+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMFF005K23+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMSF024H03+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMSF042J05+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMFF034F11+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
rJMSF033C11+ GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
                      ____________________________________________________________
consensus GATTCTTGATCGAGAAGGCCGGGGGGTACAGCAGCGATGGCAAGCAGTCCGTGCTCGACA
 
. : . : . : . : . : . :
rJMSF026C15+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMSF018O02+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMSF008E24+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMFF007C24+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMFF005K23+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMSF024H03+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMSF042J05+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMFF034F11+ AGGTGATCAATAACCTCGATGAGAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
rJMSF033C11+ AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
                      ____________________________________________________________
consensus AGGTGATCAATAACCTCGATGAAAGGACTCAAGTAGCTTATGGATCCAAGAACGAGATCA
 
. : . : . : . : . : . :
rJMSF026C15+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMSF018O02+ TCCGGTTCGAAGAGACACTNTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMSF008E24+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMFF007C24+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMFF005K23+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMSF024H03+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMSF042J05+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMFF034F11+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
rJMSF033C11+ TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
                      ____________________________________________________________
consensus TCCGGTTCGAAGAGACACTCTATGGCTCCTCCAGGCTCAAGTCTGCAGCACCAGTTGGAG
 
. : . : . : . : . : . :
rJMSF026C15+ CTTCTGCTTAAGAATGTAGCATCTTTTTAAACT
rJMSF018O02+ CTTCTGCTTAAGAATGTAGCATCTTTNTAAACTTTCCCC
rJMSF008E24+ CTTCTGCTTAAGAATGTAGCATCTTTTTAAACTTTCCCCTTTCT
rJMFF007C24+ CTTCTGCTTAAG
rJMFF005K23+ CTTCTGCTTAAG
rJMSF024H03+ CTTCTGCTTAAG
rJMSF042J05+ CTTCTGCTTAAGAATGTAGCATCTTTTTAAACTTTCCCCTTTCTGTAATTC
rJMFF034F11+ CTTCTGCTTAAGAATGTAGCATCTTTTTAAACTTTCCCCTTTCTGTAATTCTGTCATT
rJMSF033C11+ CTTCTGCTTAAGAATGTAGCATCTTTTTAAACTTTCCCCTTTCTGTAATTCTGTCATTCT
                      ____________________________________________________________
consensus CTTCTGCTTAAGAATGTAGCATCTTTTTAAACTTTCCCCTTTCTGTAATTCTGTCATTCT