Previous Contig 012876:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017E15Sequence402012876 (4)gb:AB006708_15100550.002Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.
JMSF020K09Sequence434012876 (4)gb:AB006708_15100550.002Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.376012876 (4)gb:AB006708_15100550.002Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.
JMSF033A11Sequence445012876 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020K09+ CCGATACCCAACCAAAGGACAATCGCCAGCACCGGAGCATCG
JMFN017E15- CCGATACCCAACCAAAGGACGATCGCCAGGACCGGAGCATCG
JMSF020K09- GACCCGATACCCAACCAAAGGACAATCGCCAGCACCGGAGCATCG
                      ____________________________________________________________
consensus GACCCGATACCCAACCAAAGGACAATCGCCAGCACCGGAGCATCG
 
. : . : . : . : . : . :
rJMSF020K09+ GCGGTGGCGCTGAGGGATTTCCACCGGCCGATCACGCGATCATTGAAGGCGGTGCATCGA
JMFN017E15- GCGGTGGCGCTTAGGGATTTCCACCGGCCGATCACGCGATCATTGAAGGAGGTGCATCGG
JMSF020K09- GCGGTGGCGCTGAGGGATTTCCACCGGCCGATCACGCGATCATTGAAGGCGGTGCATCGA
                      ____________________________________________________________
consensus GCGGTGGCGCTGAGGGATTTCCACCGGCCGATCACGCGATCATTGAAGGCGGTGCATCGA
 
. : . : . : . : . : . :
rJMSF020K09+ CGCAAAACATCTTCGTCGGCTACAGCAATGGCGGGATCATTTCGCGGAGGAGATTTCCGT
JMFN017E15- CTCAAAACATCGTCGTCGGCTACAGCAATGGCGGGATCATTTCGCGGAGGAGATTTCCGT
JMSF020K09- CGCAAAACATCTTCGTCGGCTACAGCAATGGCGGGATCATTTCGCGGAGGAGATTTCCGT
                      ____________________________________________________________
consensus CGCAAAACATCTTCGTCGGCTACAGCAATGGCGGGATCATTTCGCGGAGGAGATTTCCGT
 
. : . : . : . : . : . :
rJMSF020K09+ TTCAGTAGCACCTCCCGGATCCTCCGTGTCAGATCGACTTTCTGACCAAAATCTTCCAGA
JMFN017E15- TTCAGTAGCACCTCCCGGATCCTCCGTGTCAGATCGACTTTCTGACCAAAATCTTCCAGA
JMSF020K09- TTCAGTAGCACCTCCCGGATCCTCCGTGTCAGATCGACTTTCTGACCAAAATCTTCCAGA
                      ____________________________________________________________
consensus TTCAGTAGCACCTCCCGGATCCTCCGTGTCAGATCGACTTTCTGACCAAAATCTTCCAGA
 
. : . : . : . : . : . :
rJMSF020K09+ ATGGCCGACTCCACCGGCGAAATGTCCATCTCTTCCAATTATGGAACCCAAAAGCTAAGT
JMFN017E15- ATGGCCGACTCCACCGGCGAAATGTCCATCTCTTCCAATTATGGAACCCAAAAGCTAAGT
JMSF020K09- ATGGCCGACTCCACCGGCGAAATGTCCATCTCTTCCAATTATGGAACCCAAAAGCTAAGT
rJMSF033A11+ AACCCAAAAGCTAAGT
                      ____________________________________________________________
consensus ATGGCCGACTCCACCGGCGAAATGTCCATCTCTTCCAATTATGGAACCCAAAAGCTAAGT
 
. : . : . : . : . : . :
rJMSF020K09+ GTTCTTATGCCATTGATTATTTGGTGAAAATCAACATATGAATTTGCCTTTATCATCATC
JMFN017E15- GTTATTATGCCATTGATTATTTGGTGAAAATCAACATATGAATTTGCCTTTATCATCATC
JMSF020K09- GTTCTTATGCCATTGATTATTTGGTGAAAATCAACATATGAATTTGCCTTTATCATCATC
rJMSF033A11+ GTTCTTATGCCATTGATTATCTGGTGCAAATCAACATATGAATCCGCCNTTATCATCATC
                      ____________________________________________________________
consensus GTTCTTATGCCATTGATTATTTGGTGAAAATCAACATATGAATTTGCCTTTATCATCATC
 
. : . : . : . : . : . :
rJMSF020K09+ TTAATCTTGTTTGGTTTTAAGACTTTGATA
JMFN017E15- TTAATCTTGTTTGGTTTTAAGACTTTGATAATTAAATTTTTCAGATCTAAGATTT
JMSF020K09- TTAATCTTGTTTGGTTTTAAGACTTTGATAATTAAACTTTTCAGATCTAAGATTTTGAGC
rJMSF033A11+ TTNATCTCGTTTGATTTTAAGACTTTGATANTTGAACTCNTCAGATCTAAGATTTNGANC
                      ____________________________________________________________
consensus TTAATCTTGTTTGGTTTTAAGACTTTGATAATTAAACTTTTCAGATCTAAGATTTTGAGC
 
. : . : . : . : . : . :
JMSF020K09- ATGCTTGAATAGTTGGACT
rJMSF033A11+ ATGCNNGAATANTTGGACTCTNATAATAACNTGCTCATCAAATTAGCTTTCCCGGGTTNA
                      ____________________________________________________________
consensus ATGCTTGAATAGTTGGACTCTNATAATAACNTGCTCATCAAATTAGCTTTCCCGGGTTNA
 
. : . : . : . : . : . :
rJMSF033A11+ TACNCGCATAATTTTAATCACGTTTTGGATCCTATGCATGNTCATGGTTTAACAANGGTA
                      ____________________________________________________________
consensus TACNCGCATAATTTTAATCACGTTTTGGATCCTATGCATGNTCATGGTTTAACAANGGTA
 
. : . : . : . : . : . :
rJMSF033A11+ NTNANNTTCGAANGNGTATGNTCNTAANNTTTTGAGCTGTGCAAAGTTCCNGAANNTNNT
                      ____________________________________________________________
consensus NTNANNTTCGAANGNGTATGNTCNTAANNTTTTGAGCTGTGCAAAGTTCCNGAANNTNNT