Previous Contig 012861:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032L22Sequence662012861 (2)gb:AF139500_17714352e-55Prunus armeniaca p69RF mRNA, partial cds.725012861 (2)gb:AF139500_17714353e-70Prunus armeniaca p69RF mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032L22- GGTGGATGAAAT
                      ____________________________________________________________
consensus GGTGGATGAAAT
 
. : . : . : . : . : . :
JMSF032L22- AAATACAAATTATTAAGTTTTCTTCCTCTGGTCTTTCTCTAAATTTCTTCCCCTTTCTTC
                      ____________________________________________________________
consensus AAATACAAATTATTAAGTTTTCTTCCTCTGGTCTTTCTCTAAATTTCTTCCCCTTTCTTC
 
. : . : . : . : . : . :
JMSF032L22- TGCAAGTCTTTTCTTCACACAAAAATGGGTGCTACTAAGGTTACAGATGATGGAACCTAT
                      ____________________________________________________________
consensus TGCAAGTCTTTTCTTCACACAAAAATGGGTGCTACTAAGGTTACAGATGATGGAACCTAT
 
. : . : . : . : . : . :
JMSF032L22- GACAGAACAACCGAAATCAAAACATTCGACGAGACGAAAGCCGGCGTTAAGGGTCTAGTC
                      ____________________________________________________________
consensus GACAGAACAACCGAAATCAAAACATTCGACGAGACGAAAGCCGGCGTTAAGGGTCTAGTC
 
. : . : . : . : . : . :
JMSF032L22- GACGCCGGAATCACCAAAGTTCCTCGGATGTTTTACACTCCGCCGGATCCCTTTGTTCAG
                      ____________________________________________________________
consensus GACGCCGGAATCACCAAAGTTCCTCGGATGTTTTACACTCCGCCGGATCCCTTTGTTCAG
 
. : . : . : . : . : . :
JMSF032L22- GCATCATCAGACAAAACCGGCCGTTTCAGTATTCCGGTGATAGACCTGCAGGGCATATAC
                      ____________________________________________________________
consensus GCATCATCAGACAAAACCGGCCGTTTCAGTATTCCGGTGATAGACCTGCAGGGCATATAC
 
. : . : . : . : . : . :
JMSF032L22- AACAGTAGTGGGGATGGTTCAGTGCAACGTAGGGAGGTGGTCGACAAGGTCCGAGGTGCA
                      ____________________________________________________________
consensus AACAGTAGTGGGGATGGTTCAGTGCAACGTAGGGAGGTGGTCGACAAGGTCCGAGGTGCA
 
. : . : . : . : . : . :
JMSF032L22- TCGGAGGTGTGGGGGTTTTTCCAGGTGGTCAATCATGGGATTCCTGCCAGTATCCTGGAA
                      ____________________________________________________________
consensus TCGGAGGTGTGGGGGTTTTTCCAGGTGGTCAATCATGGGATTCCTGCCAGTATCCTGGAA
 
. : . : . : . : . : . :
JMSF032L22- GAGATGTTGGGTGGTACCAGGAGATTCTATGAACAAGATAGTGAGGTGAAGAAACAATGG
                      ____________________________________________________________
consensus GAGATGTTGGGTGGTACCAGGAGATTCTATGAACAAGATAGTGAGGTGAAGAAACAATGG
 
. : . : . : . : . : . :
JMSF032L22- TACACGCGAGACAGTTCGAAGAGAGTTGTTTATAACAGCAACTTTGATTTGTATAGTGCA
                      ____________________________________________________________
consensus TACACGCGAGACAGTTCGAAGAGAGTTGTTTATAACAGCAACTTTGATTTGTATAGTGCA
 
. : . : . : . : . : . :
JMSF032L22- GGCTCCGCTAACTGGAGGGACACAACTTACTGCAGCATGGCTCCTTATCCTCCCAGTCCA
rJMSF032L22+ GTCCA
                      ____________________________________________________________
consensus GGCTCCGCTAACTGGAGGGACACAACTTACTGCAGCATGGCTCCTTATCCTCCCAGTCCA
 
. : . : . : . : . : . :
JMSF032L22- GATGAATTGCCAGANGCCTGTAGAGATATACTGATTGAGTACTCTGAGC
rJMSF032L22+ GATGNATTGCCAGAGGCCTGTAGAGATATACTGATTGAGTACTCTGAGCCAAGTTAAGAA
                      ____________________________________________________________
consensus GATGAATTGCCAGAGGCCTGTAGAGATATACTGATTGAGTACTCTGAGCCAAGTTAAGAA
 
. : . : . : . : . : . :
rJMSF032L22+ GTTAGGGCTTACCTTATTTGGTTTGCTTTCTGAGGCTCTTGGCCTAAACCCGAACCATTT
                      ____________________________________________________________
consensus GTTAGGGCTTACCTTATTTGGTTTGCTTTCTGAGGCTCTTGGCCTAAACCCGAACCATTT
 
. : . : . : . : . : . :
rJMSF032L22+ GAATGAGATTGGGTGCCCGGAAGGACTAGCCGTTCTGTACCATTACTATCCAGCATGCCC
                      ____________________________________________________________
consensus GAATGAGATTGGGTGCCCGGAAGGACTAGCCGTTCTGTACCATTACTATCCAGCATGCCC
 
. : . : . : . : . : . :
rJMSF032L22+ TGAACCAGAACTAACCATTGGAGCCAGCAAGCATTCTGATTCTGACTTCATGACAGTCCT
                      ____________________________________________________________
consensus TGAACCAGAACTAACCATTGGAGCCAGCAAGCATTCTGATTCTGACTTCATGACAGTCCT
 
. : . : . : . : . : . :
rJMSF032L22+ ACTACAAGACCATATTGGAGGCCTTCAAATCCTCCATGACAATCTTTGGGTTGATGTTCC
                      ____________________________________________________________
consensus ACTACAAGACCATATTGGAGGCCTTCAAATCCTCCATGACAATCTTTGGGTTGATGTTCC
 
. : . : . : . : . : . :
rJMSF032L22+ CCCTGTACCCGGAGCTTTAGTCATAAACATTGGTGATCTCTTACAGCTGATATCAAATGA
                      ____________________________________________________________
consensus CCCTGTACCCGGAGCTTTAGTCATAAACATTGGTGATCTCTTACAGCTGATATCAAATGA
 
. : . : . : . : . : . :
rJMSF032L22+ CAGGTTCAAGAGTGTTGCACACAGAGTGGTGGCCAGTGATGTTGGTCCAAGGGTATCAGT
                      ____________________________________________________________
consensus CAGGTTCAAGAGTGTTGCACACAGAGTGGTGGCCAGTGATGTTGGTCCAAGGGTATCAGT
 
. : . : . : . : . : . :
rJMSF032L22+ GGCCAGCTTCTTCACCACCGGCCATGTACCATCATCAAGGATCTATGGTCCGATCAAGGA
                      ____________________________________________________________
consensus GGCCAGCTTCTTCACCACCGGCCATGTACCATCATCAAGGATCTATGGTCCGATCAAGGA
 
. : . : . : . : . : . :
rJMSF032L22+ ATTGTTGTGTGAAGATAATCCTGCAAAGTATAGGGAAACTACAGTGAGAGACTACTCAGT
                      ____________________________________________________________
consensus ATTGTTGTGTGAAGATAATCCTGCAAAGTATAGGGAAACTACAGTGAGAGACTACTCAGT
 
. : . : . : . : . : . :
rJMSF032L22+ TCACTATGATGCAACAGGGCTTGGAGGTAAATCTGCCTTGTTAGGTTTCAGGCTCTAGAT
                      ____________________________________________________________
consensus TCACTATGATGCAACAGGGCTTGGAGGTAAATCTGCCTTGTTAGGTTTCAGGCTCTAGAT
 
. : . : . : . : . : . :
rJMSF032L22+ AAACTTTGTAGTACAGATTAGTATCAGTTTGGTTTGTATTAAGTAATTCTCAATACTTTA
                      ____________________________________________________________
consensus AAACTTTGTAGTACAGATTAGTATCAGTTTGGTTTGTATTAAGTAATTCTCAATACTTTA
 
. : . : . : . : . : . :
rJMSF032L22+ CAATTAATTAATCATATGTTGTTGAGATTACAACTTGAGTCTTAAAGGCTGACCAATTGT
                      ____________________________________________________________
consensus CAATTAATTAATCATATGTTGTTGAGATTACAACTTGAGTCTTAAAGGCTGACCAATTGT