Previous Contig 012859:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032L16Sequence693006842 (3)gb:AJ849377_18147501e-07Lycopersicon esculentum mRNA for 1,4-alpha-glucan-maltohydrolase (bmy3 gene).745012859 (2)gb:AJ849377_18147509e-67Lycopersicon esculentum mRNA for 1,4-alpha-glucan-maltohydrolase (bmy3 gene).
JMSF035K21Sequence700006842 (3)gb:AJ849377_18147501e-39Lycopersicon esculentum mRNA for 1,4-alpha-glucan-maltohydrolase (bmy3 gene).727012859 (2)gb:AJ849377_18147503e-55Lycopersicon esculentum mRNA for 1,4-alpha-glucan-maltohydrolase (bmy3 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035K21+ AGGAGCATNGTGGATCATGGG
rJMSF032L16+ TTCAAGGAGCATGGTGGATCATGGG
                      ____________________________________________________________
consensus TTCAAGGAGCATGGTGGATCATGGG
 
. : . : . : . : . : . :
rJMSF035K21+ AGACGACTTATGGGGA-TTTTTCCTTTC-TGGTATTCCAACCAGCTTATTACACACGGAG
rJMSF032L16+ AGACGACTTATGGTGATTTTTTCCTTTCTTGGTATTCCAACCAGCTTATTACACACGGAG
                      ____________________________________________________________
consensus AGACGACTTATGGTGATTTTTTCCTTTCTTGGTATTCCAACCAGCTTATTACACACGGAG
 
. : . : . : . : . : . :
rJMSF035K21+ ATCAACTTCTTTCGGTTGCTGCCTCCACTTTCAGTGATGTCCCCGAGATTACAGTTTGTG
rJMSF032L16+ ATCAACTTCTTTCGGTTGCTGCCTCCACTTTCAGTGATGTCCCCGAGATTACAGTTTGTG
                      ____________________________________________________________
consensus ATCAACTTCTTTCGGTTGCTGCCTCCACTTTCAGTGATGTCCCCGAGATTACAGTTTGTG
 
. : . : . : . : . : . :
rJMSF035K21+ GAAAAGTTCCTCTAATCCATTCTTGGTACAAAACTCGTTCCCACCCAGCAGAGCTGGTCG
rJMSF032L16+ GAAAAGTTCCTCTAATCCATTCTTGGTACAAAACTCGTTCCCACCCAGCAGAGCTGGTCG
                      ____________________________________________________________
consensus GAAAAGTTCCTCTAATCCATTCTTGGTACAAAACTCGTTCCCACCCAGCAGAGCTGGTCG
 
. : . : . : . : . : . :
rJMSF035K21+ CTGGGATCTACAACACGGAGAACAGAGATGGCTACGAAGCTATAGTTGAGATGTTCTCGA
rJMSF032L16+ CTGGGATCTACAACACGGAGAACAGAGATGGCTACGAAGCTATAGTTGAGATGTTCTCGA
                      ____________________________________________________________
consensus CTGGGATCTACAACACGGAGAACAGAGATGGCTACGAAGCTATAGTTGAGATGTTCTCGA
 
. : . : . : . : . : . :
rJMSF035K21+ AGAACAAGTGCAAAATAATCTTGCCAGGAATGGACCTGTCTGACGAGCAGCAGCCAAAGG
rJMSF032L16+ AGAACAAGTGCAAAATAATCTTGCCAGGAATGGACCTGTCTGACGAGCAGCAGCCAAAGG
                      ____________________________________________________________
consensus AGAACAAGTGCAAAATAATCTTGCCAGGAATGGACCTGTCTGACGAGCAGCAGCCAAAGG
 
. : . : . : . : . : . :
rJMSF035K21+ AATCCCTCTCGAGTCCAGAATCGTTGCTTGCACAAATTGCATTGTGTTGCAGAAAGCATG
rJMSF032L16+ AATCCCTCTCGAGTCCAGAATCGTTACTTGCACAAATTGCATTGTGTTGCAGAAAGCATG
                      ____________________________________________________________
consensus AATCCCTCTCGAGTCCAGAATCGTTGCTTGCACAAATTGCATTGTGTTGCAGAAAGCATG
 
. : . : . : . : . : . :
rJMSF035K21+ GAGTTGAAATCCTTGGCCAGAACTCAACGGCTTCCAACGCTGCTGCCAGTGGTTTCGAAC
rJMSF032L16+ GAGTTGAAATCCTTGGCCAGAACTCAACGGCTTCCAACGCTGCTGCCAGTGGTTTCGAAC
                      ____________________________________________________________
consensus GAGTTGAAATCCTTGGCCAGAACTCAACGGCTTCCAACGCTGCTGCCAGTGGTTTCGAAC
 
. : . : . : . : . : . :
rJMSF035K21+ AGATCAGAAAGTACTTAGCGGGTGAAAGTGCAGCAGCCATCAGCTTGTTCACCTATCAAC
rJMSF032L16+ AGATCAGAAAGTACTTAGCGGGTGAAAGTGCAGCAGCCATCAGCTTGTTCACCTATCAAC
                      ____________________________________________________________
consensus AGATCAGAAAGTACTTAGCGGGTGAAAGTGCAGCAGCCATCAGCTTGTTCACCTATCAAC
 
. : . : . : . : . : . :
rJMSF035K21+ GGATGGGGGCGTATTTCTTCTCCCCCGACCATTTTCCTTCTTTCACCAAATTCATGC-CA
rJMSF032L16+ GGATGGGGGCGTATTTCTTCTCCCCCGACCATTTTCCTTCTTTCACCAAATTCATGCGCA
                      ____________________________________________________________
consensus GGATGGGGGCGTATTTCTTCTCCCCCGACCATTTTCCTTCTTTCACCAAATTCATGCGCA
 
. : . : . : . : . : . :
rJMSF035K21+ ACCTCAGGGAACTCGAACTGGAACTCGATTCAGATGATCAGCCTGCTGGATCATCTCTTT
rJMSF032L16+ ACCTCAGGGAACTCGAACTGGAACTCGATTCAGATGATCAGCCTGCTGGATCATCTCTTT
                      ____________________________________________________________
consensus ACCTCAGGGAACTCGAACTGGAACTCGATTCAGATGATCAGCCTGCTGGATCATCTCTTT
 
. : . : . : . : . : . :
rJMSF035K21+ CTGCCAGGAACCTACAAGAGCAAGCTGCTTAGACATGCCATGCCTAGTATTATAATATAG
rJMSF032L16+ CTGCCAGGAACCTACAAGAGCAAGCTGCTTAGACATGCCATGCCTAGTATTATAATATAG
                      ____________________________________________________________
consensus CTGCCAGGAACCTACAAGAGCAAGCTGCTTAGACATGCCATGCCTAGTATTATAATATAG
 
. : . : . : . : . : . :
rJMSF035K21+ ATAAGATATTGAATGTGAAATTAGTAAGTGTTAAATATAGAAAAAGAGC
rJMSF032L16+ ATAAGATATTGAATGTGAAATTAGTAAGTGTTAAATATAGAAAAAGAGCTAAAGCTGTAT
                      ____________________________________________________________
consensus ATAAGATATTGAATGTGAAATTAGTAAGTGTTAAATATAGAAAAAGAGCTAAAGCTGTAT