Previous Contig 012858:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024K10Sequence675006231 (2)gb:AB020749_15146562e-74Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.192012858 (3)
JMSF025K10Sequence186012858 (3)
JMSF032L12Sequence658006231 (2)gb:AB020749_15146564e-70Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.217012858 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025K10+ TTTTTTTNTCAATNA
rJMSF024K10+ CCTTTTTTTTTTTTTTANGGNTTTTTTTTTTCAATAA
rJMSF032L12+ TTTTTTTTTCAATAA
                      ____________________________________________________________
consensus CCTTTTTTTTTTTTTTANGGNTTTTTTTTTTCAATAA
 
. : . : . : . : . : . :
rJMSF025K10+ ACNAAATCAAGGTCANCAGTACTGCAAAATCATTGAAGAGAAGCCCCTTTCAGTATTATG
rJMSF024K10+ ACTAAATCAAGGTCAACAGTACTGCAAAATCATTGAAGAGAAGCCCCTTTCAGTATTATG
rJMSF032L12+ ACTAAATCAAGGTCAACAGTACTGCAAAATCATTGAAGAGAAGCCCCTTTCAGTATTATG
                      ____________________________________________________________
consensus ACTAAATCAAGGTCAACAGTACTGCAAAATCATTGAAGAGAAGCCCCTTTCAGTATTATG
 
. : . : . : . : . : . :
rJMSF025K10+ ATGGTCTGGTTTGGTCGTTTCCAAGGTT-AACAGTNCTGACCAGTTTGAGCTGGAGAAAG
rJMSF024K10+ A-GGTCTGGTTTGGTCGTTTCCAAGGTT-AACAGTACTGACCAGTTTGAGCTGGAGAAAG
rJMSF032L12+ A-GGTCTGGTTTGGTCGTTTCCAAGGTTAAACAGTACTGACCAGTTTGAGCTGGAGAAAG
                      ____________________________________________________________
consensus A-GGTCTGGTTTGGTCGTTTCCAAGGTT-AACAGTACTGACCAGTTTGAGCTGGAGAAAG
 
. : . : . : . : . : . :
rJMSF025K10+ TGTGGCTTTTGACCAGTAAATGGA
rJMSF024K10+ TGTGGCTTTTGACCAGTAAATGGA
rJMSF032L12+ TGTGGCTTTTGACCAGTAAATGGANGGANACCTACCTNTTTAANGTANAATACTACTCTG
                      ____________________________________________________________
consensus TGTGGCTTTTGACCAGTAAATGGANGGANACCTACCTNTTTAANGTANAATACTACTCTG