Previous Contig 012848:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019P18Sequence584006836 (5)gb:AB019226_15140716e-10Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K24M7.>gb:BT011246_164707012848 (5)gb:AP004020_18364812e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF013M08Sequence519006836 (5)pir|T05785|T057852e-08hypothetical protein M7J2.10 - Arabidopsis thaliana>gb:ATCHRIV63_1546443 Arabido711012848 (5)gb:AP004020_18364817e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF020B24Sequence687006836 (5)gb:AP004020_18364803e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11731012848 (5)gb:AP004020_18364811e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF032J11Sequence697006836 (5)gb:AP004020_18364801e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11773012848 (5)gb:AP004020_18364812e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF037D24Sequence722006836 (5)gb:AP004020_18364804e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11508012848 (5)gb:AP004020_18364818e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020B24+ AAATTCATATAATAG
                      ____________________________________________________________
consensus AAATTCATATAATAG
 
. : . : . : . : . : . :
rJMFF019P18+ CAGTACTTAATCACAGAGTTTCATTTGAGGTTACTGCAGAAGA
rJMSF020B24+ GTGGAAGAATGATGACACAGTACTTAATCACAGAGTTTCATTTGAGGTTACTGCAGAAGA
rJMSF013M08+ AGAATGATGACACAGTACTTAATCACAGAG-TTCATTTGAGGTTACTGCAGAAGA
rJMSF032J11+ CAGTACTTAATCACAGAG-TTTCATTGAGGNTACTGCAGAAGA
                      ____________________________________________________________
consensus GTGGAAGAATGATGACACAGTACTTAATCACAGAGTTTCATTTGAGGTTACTGCAGAAGA
 
. : . : . : . : . : . :
rJMFF019P18+ TTTTCTCAGGTGCATGGAAAAGAAGCCAGGATTGTTGTCCAAGGCTGGATTTGCTGCGCC
rJMSF020B24+ TTTTCTCAGGTGCATGGAAAAGAAGCCAGGATTGTTGTCCAAGGCTGGATTTGCTGCGCC
rJMSF013M08+ TTTTCTCAGGTGCATGGAAAAGAAGCCAGGATTGTTGTCCAAGGCTGGATTTGCTGCGCC
rJMSF032J11+ -TTTCTCAGGTGCATGGAAAAGAAGCCAGGATTGTTGTCCAAGGCTGGATTTGCTGCGCC
                      ____________________________________________________________
consensus TTTTCTCAGGTGCATGGAAAAGAAGCCAGGATTGTTGTCCAAGGCTGGATTTGCTGCGCC
 
. : . : . : . : . : . :
rJMFF019P18+ TCTTGAGAAAGGGAAATCTACTGCCAAAGGACAAGGATGCACTCCTGAAATGAAAATTGG
rJMSF020B24+ TCTTGAGAAAGGGAAATCTACTGCCAAAGGACAAGGATGCACTCCTGAAATGAAAATTGG
rJMSF013M08+ TCTTGAGAAAGGGAAATCTACTGCCAAAGGACAAGGATGCACTCCTGAAATGAAAATTGG
rJMSF032J11+ TCTTGAGAAAGGGAAATCTACTGCCAAAGGACAAGGATGCACTCCTGAAATGAAAATTGG
                      ____________________________________________________________
consensus TCTTGAGAAAGGGAAATCTACTGCCAAAGGACAAGGATGCACTCCTGAAATGAAAATTGG
 
. : . : . : . : . : . :
rJMFF019P18+ TCACGATTGTTTTGCAGTCGAGTCCTCAGGAGAAAGCTTCGAAAGGGCTTCTGCAAATGG
rJMSF037D24+ TCCTCAGGAGAAAGCTTCGAAAGGGCTTCTGCAAATGG
rJMSF020B24+ TCACGATTGTTTTGCAGTCGAGTCCTCAGGAGAAAGCTTCGAAAGGGCTTCTGCAAATGG
rJMSF013M08+ TCACGATTGTTTTGCAGTCGAGTCCTCAGGAGAAAGCTTCGAAAGGGCTTCTGCAAATGG
rJMSF032J11+ TCACGATTGTTTTGCAGTCGAGTCCTCAGGAGAAAGCTTCGAAAGGGCTTCTGCAAATGG
                      ____________________________________________________________
consensus TCACGATTGTTTTGCAGTCGAGTCCTCAGGAGAAAGCTTCGAAAGGGCTTCTGCAAATGG
 
. : . : . : . : . : . :
rJMFF019P18+ AGAGGATAGAAAGCAGCACCATCAGAACCAGTCTATCACTCTCGGATCTTCAGAGGAATT
rJMSF037D24+ AGAGGATAGAAAGCAGCACCATCAGAACCAGTCTATCACTCTCGGATCTTCAGAGGAATT
rJMSF020B24+ AGAGGATAGAAAGCAGCACCATCAGAACCAGTCTATCACTCTCGGATCTTCAGAGGAATT
rJMSF013M08+ AGAGGATAGAAAGCAGCACCATCAGAACCAGTCTATCACTCTCGGATCTTCAGAGGAATT
rJMSF032J11+ AGAGGATAGAAAGCAGCACCATCAGAACCAGTCTATCACTCTCGGATCTTCAGAGGAATT
                      ____________________________________________________________
consensus AGAGGATAGAAAGCAGCACCATCAGAACCAGTCTATCACTCTCGGATCTTCAGAGGAATT
 
. : . : . : . : . : . :
rJMFF019P18+ CAACTTTTTTGACAACATAAACGATGAACTCTCTGACAAGCCTAGTGTTGCTGGCTCCGA
rJMSF037D24+ CAACTTTTTTGACAACATAAACGATGAACTCTCTGACAAGCCTAGTGTTGCTGGCTCCGA
rJMSF020B24+ CAACTTTTTTGACAACATAAACGATGAACTCTCTGACAAGCCTAGTGTTGCTGGCTCCGA
rJMSF013M08+ CAACTTTTTTGACAACATAAACGATGAACTCTCTGACAAGCCTAGTGTTGCTGGCTCCGA
rJMSF032J11+ CAACTTTTTTGACAACATAAACGATGAACTCTCTGACAAGCCTAGTGTTGCTGGCTCCGA
                      ____________________________________________________________
consensus CAACTTTTTTGACAACATAAACGATGAACTCTCTGACAAGCCTAGTGTTGCTGGCTCCGA
 
. : . : . : . : . : . :
rJMFF019P18+ CTGGTGGGCCAACGAGAAGGATCTCGGTCAGGGTTCCAGTCCTTGCCAGAAGTGGTCTTT
rJMSF037D24+ CTGGTGGGCCAACGAGAAGGATCTCGGTCAGGGTTCCAGTCCTTGCCAGAAGTGGTCTTT
rJMSF020B24+ CTGGTGGGCCAACGAGAAGGATCTCGGTCAGGGTTCCAGTCCTTGCCAGAAGTGGTCTTT
rJMSF013M08+ CTGGTGGGCCAACGAGAAGGATCTCGGTCAGGGTTCCAGTCCTTGCCAGAAGTGGTCTTT
rJMSF032J11+ CTGGTGGGCCAACGAGAAGGATCTCGGTCAGGGTTCCAGTCCTTGCCAGAAGTGGTCTTT
                      ____________________________________________________________
consensus CTGGTGGGCCAACGAGAAGGATCTCGGTCAGGGTTCCAGTCCTTGCCAGAAGTGGTCTTT
 
. : . : . : . : . : . :
rJMFF019P18+ CTTCCCGATGGTACAGCCAGGGATAAGCTAATCCACGCATCAGGCAAGTAAACACTAAAC
rJMSF037D24+ CTTCCCGATGGTACAGCCAGGGATAAGCTAATCCACGCATCAGGCAAGTAAACACTAAAC
rJMSF020B24+ CTTCCCGATGGTACAGCCAGGGATAAGCTAATCCACGCATCAGGCAAGTAAACACTAAAC
rJMSF013M08+ CTTCCCGATGGTACAGCCAGGGATAAGCTAATCCACGCATCAGGCAAGT-AACACTAAAC
rJMSF032J11+ CTTCCCGATGGTACAGCCAGGGATAAGCTAATCCACGCATCAGGCAAGTAAACACTAAAC
                      ____________________________________________________________
consensus CTTCCCGATGGTACAGCCAGGGATAAGCTAATCCACGCATCAGGCAAGTAAACACTAAAC
 
. : . : . : . : . : . :
rJMFF019P18+ AGCATTTCTCTTGAAAGATTTGAAACACAGCAGCTTTGAGCTAAATAGACAGGTAGTGAT
rJMSF037D24+ AGCATTTCTCTTGAAAGATTTGAAACACAGCAGCTTTGAGCTAAATAGACAGGTAGTGAT
rJMSF020B24+ AGCATTTCTCTTGAAAGATTTGAAACACAGCAGCTTTGAGCTAAATAGACAGGTAGTGAT
rJMSF013M08+ AGCATTTCTCTTGAAAGATTTGAAACACAGCAGCTTTGAGCTAAATAGACAGGTAGTGAT
rJMSF032J11+ AGCATTTCTCTTGAAAGATTTGAAACACAGCAGCTTTGAGCTAAATAGACAGGTAGTGAT
                      ____________________________________________________________
consensus AGCATTTCTCTTGAAAGATTTGAAACACAGCAGCTTTGAGCTAAATAGACAGGTAGTGAT
 
. : . : . : . : . : . :
rJMFF019P18+ AACAAAGCCATTGAAGTATATCATTTGAAGGCTGTTTTTGGAGCACTTCCTGACATTAGA
rJMSF037D24+ AACAAAGCCATTGAAGTATATCATTNGAAGGCTGTTTTTGGAGCACTTCCTGACATTAGA
rJMSF020B24+ AACAAAGCCATTGAAGTATATCATTTGAAGGCTGTTTTTGGAGCACTTCCTGACATTAGA
rJMSF013M08+ AACAAAGCCATTGAAGTATATCATTTGAAGGCTGTTTTTGGAGCACTTCCTGACATTAGA
rJMSF032J11+ AACAAAGCCATTGAAGTATATCATTTGAAGGCTGTTTTTGGAGCACTTCCTGACATTAGA
                      ____________________________________________________________
consensus AACAAAGCCATTGAAGTATATCATTTGAAGGCTGTTTTTGGAGCACTTCCTGACATTAGA
 
. : . : . : . : . : . :
rJMFF019P18+ AAAAGGATAAATAGGTGGTATGCATTTTGGTTTTATAGCATGGATAAAGTAGTTTTTCTT
rJMSF037D24+ AAAAGGATAAATAGGTGGTATGCATTTTGGTTTTATAGCATGGATAAAGTAGTTTTTCTT
rJMSF020B24+ AAAAGGATAAATAGGTGGTATGCATTTTGGTTTTATAGCATGGATAAAGTAGTTTTTCTT
rJMSF013M08+ AAAAGGATAAATAGGTGGTATGCATTTTGGTTTTATAGCATGGATAAAGTAGTTTTTCTT
rJMSF032J11+ AAAAGGATAAATAGGTGGTATGCATTTTGGTTTTATAGCATGGATAAAGTAGTTTTTCTT
                      ____________________________________________________________
consensus AAAAGGATAAATAGGTGGTATGCATTTTGGTTTTATAGCATGGATAAAGTAGTTTTTCTT
 
. : . : . : . : . : . :
rJMFF019P18+ CT-CCTGCGTGAGAAGCAGATTGACTCATAGTATTAGAGT-CTNGAGATA
rJMSF037D24+ CTGCCCGCGTGAGAAGCAGACTGACTCATAGTATTAGAGTACTAGAGATA
rJMSF020B24+ CT-CCTGCGTGAGAAGCAGATTGACTCATAGTATTAGAGT-CTAGAGATACTTGCTTT
rJMSF013M08+ CT-CCTGCGTGAGAAGCAGATTGACTCATAGTATTAGAGT-CTAGAGATACTTGCTTT
rJMSF032J11+ CT-CCTGCGTGAGAAGCAGATTGACTCATAGTATTAGAGT-CTAGAGATACTTGCTTTTG
                      ____________________________________________________________
consensus CT-CCTGCGTGAGAAGCAGATTGACTCATAGTATTAGAGT-CTAGAGATACTTGCTTTTG
 
. : . : . : . : . : . :
rJMSF032J11+ ACCTTTCAATTGTGTAATATAAATAATACATAGATTTATGACAGTTATTAGGATAAAATT
                      ____________________________________________________________
consensus ACCTTTCAATTGTGTAATATAAATAATACATAGATTTATGACAGTTATTAGGATAAAATT