Previous Contig 012840:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032H10Sequence660012840 (2)gb:AC084405_17336111e-55Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.728012840 (2)gb:AB087837_15247219e-61Pisum sativum GST mRNA for glutathione S-transferase, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032H10- TTGGATGAGTGGAGTTCTAGAATCTAATCAATCATTGCTACTTCCCAGTT
                      ____________________________________________________________
consensus TTGGATGAGTGGAGTTCTAGAATCTAATCAATCATTGCTACTTCCCAGTT
 
. : . : . : . : . : . :
JMSF032H10- CCTACGTTTTTATCGGGATCCCTATATCACACCAGCATTTCTCTCCGTCCTTAAAGCTCC
                      ____________________________________________________________
consensus CCTACGTTTTTATCGGGATCCCTATATCACACCAGCATTTCTCTCCGTCCTTAAAGCTCC
 
. : . : . : . : . : . :
JMSF032H10- GATCATCGAACTCCATTTGTCACCACTATAAAGCTTTCTGTCATAGTGTCATCGTTCCCA
                      ____________________________________________________________
consensus GATCATCGAACTCCATTTGTCACCACTATAAAGCTTTCTGTCATAGTGTCATCGTTCCCA
 
. : . : . : . : . : . :
JMSF032H10- GCAGTAGAAATCCATTCGCTTTTACGATCTGAGGAGCAAAGGTTACTACAATGGCTGCCC
                      ____________________________________________________________
consensus GCAGTAGAAATCCATTCGCTTTTACGATCTGAGGAGCAAAGGTTACTACAATGGCTGCCC
 
. : . : . : . : . : . :
JMSF032H10- CATTCGTTGCAGAGGTTCTCCCTCCATATTTGGATTCCACCTCTGAGCCGCCGCAGCTCT
                      ____________________________________________________________
consensus CATTCGTTGCAGAGGTTCTCCCTCCATATTTGGATTCCACCTCTGAGCCGCCGCAGCTCT
 
. : . : . : . : . : . :
JMSF032H10- TCGACGGAACCACCAGGTTGTATACCAATTTCCAGTGCCCTTATGCTCAGCGTGTTTGGA
                      ____________________________________________________________
consensus TCGACGGAACCACCAGGTTGTATACCAATTTCCAGTGCCCTTATGCTCAGCGTGTTTGGA
 
. : . : . : . : . : . :
JMSF032H10- TTATTAGAAATTACAAGGGTTTACAAGATAAGATAAAATTTGTTGCAATTGATCTTCAGA
rJMSF032H10+ TCTTCAGA
                      ____________________________________________________________
consensus TTATTAGAAATTACAAGGGTTTACAAGATAAGATAAAATTTGTTGCAATTGATCTTCAGA
 
. : . : . : . : . : . :
JMSF032H10- ACAGGCCTGCTTGGTACAAGGAAAAAGTGTACCCTGAAAACAAGGTGCCTGCATTGGAGC
rJMSF032H10+ ACAGGCCTGCTTGGTACAAGGAAAAAGTGTACCCTGAAAACAAGGTGCCTGCATTGGAGC
                      ____________________________________________________________
consensus ACAGGCCTGCTTGGTACAAGGAAAAAGTGTACCCTGAAAACAAGGTGCCTGCATTGGAGC
 
. : . : . : . : . : . :
JMSF032H10- ACAACAACAAAATAATTGGGGAGAGTTTGGACTTGGTTAAGTATATCGATAGTAACTTTG
rJMSF032H10+ ACAACAACAAAATAATTGGGGAGAGTTTGGACTTGGTTAAGTATATCGATAGTAACTTTG
                      ____________________________________________________________
consensus ACAACAACAAAATAATTGGGGAGAGTTTGGACTTGGTTAAGTATATCGATAGTAACTTTG
 
. : . : . : . : . : . :
JMSF032H10- AAGGGCCTTCTCTTTTACCCAATGATCCTGAGAAGCAGAAGTTTGCTGAAGAGTTGATAG
rJMSF032H10+ AAGGGCCTTCTCTTTTACCCAATGATCCTGAGAAGCAGAAGTTTGCTGAAGAGTTGATAG
                      ____________________________________________________________
consensus AAGGGCCTTCTCTTTTACCCAATGATCCTGAGAAGCAGAAGTTTGCTGAAGAGTTGATAG
 
. : . : . : . : . : . :
JMSF032H10- CCTACACTGACACATTCAACAAAGAAGTGTTCGGTTCATTCAAGGGAAACCCAGAGAAAG
rJMSF032H10+ CCTACACTGACACATTCAACAAAGAAGTGTTCGGTTCATTCAAGGGAAACCCAGAGAAAG
                      ____________________________________________________________
consensus CCTACACTGACACATTCAACAAAGAAGTGTTCGGTTCATTCAAGGGAAACCCAGAGAAAG
 
. : . : . : . : . : . :
JMSF032H10- ATGCAGCTGG
rJMSF032H10+ ATGCAGCTGGTGCCTTTGACCACATAGAAAAAGCACTTGGCAAATATGATGGTCCTTTCT
                      ____________________________________________________________
consensus ATGCAGCTGGTGCCTTTGACCACATAGAAAAAGCACTTGGCAAATATGATGGTCCTTTCT
 
. : . : . : . : . : . :
rJMSF032H10+ TCCTTGGAGAATTCAGTCAGGTAGACATTGCTTATGCTCCGTTCATTGAAAGGCTCCGGC
                      ____________________________________________________________
consensus TCCTTGGAGAATTCAGTCAGGTAGACATTGCTTATGCTCCGTTCATTGAAAGGCTCCGGC
 
. : . : . : . : . : . :
rJMSF032H10+ CCTTCATACTAGAAGTGTTTAAGTATGACGTTACATCGAGCAGGCCTAAACTAGCAACAT
                      ____________________________________________________________
consensus CCTTCATACTAGAAGTGTTTAAGTATGACGTTACATCGAGCAGGCCTAAACTAGCAACAT
 
. : . : . : . : . : . :
rJMSF032H10+ GGATTGAGGAGGTGGAGAAGATTGATGCTTACACGGTGACAAAATGTGATCTCCCGAAGA
                      ____________________________________________________________
consensus GGATTGAGGAGGTGGAGAAGATTGATGCTTACACGGTGACAAAATGTGATCTCCCGAAGA
 
. : . : . : . : . : . :
rJMSF032H10+ CCATTGAATTCTTCAAGACTCGCTTTATGGCCTGAAATTTGAGTTGTGTTTGATCTCTGC
                      ____________________________________________________________
consensus CCATTGAATTCTTCAAGACTCGCTTTATGGCCTGAAATTTGAGTTGTGTTTGATCTCTGC
 
. : . : . : . : . : . :
rJMSF032H10+ CGTTGATAAGATTGTGTGGCTTTCATCAAGATGTGATGCTGTTTGCAACATTGATTCCTA
                      ____________________________________________________________
consensus CGTTGATAAGATTGTGTGGCTTTCATCAAGATGTGATGCTGTTTGCAACATTGATTCCTA
 
. : . : . : . : . : . :
rJMSF032H10+ AACATTGTAATGCATCATAGAATCTTGTATAGTTTACTTTGTGTTAAATTCCTGGTTGAT
                      ____________________________________________________________
consensus AACATTGTAATGCATCATAGAATCTTGTATAGTTTACTTTGTGTTAAATTCCTGGTTGAT
 
. : . : . : . : . : . :
rJMSF032H10+ CTATACTTCCACTGTTGATTCGACAATTGTAATGTTTGGTGGGGGGCAGAGGTTCCCATT
                      ____________________________________________________________
consensus CTATACTTCCACTGTTGATTCGACAATTGTAATGTTTGGTGGGGGGCAGAGGTTCCCATT