Previous Contig 012838:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031L16Sequence520012838 (4)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.489012838 (4)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF032H06Sequence514012838 (4)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.457012838 (4)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032H06- GACCAATTCTTCAATCTTCCAATCGAAACCCTAGAAA
rJMFF031L16+ AATTCTTCAATCTTCCAATCGAAACCCTAGAAA
JMFF031L16- AATTCTTCAATCTTCCAATCGAAACCCTAGAAA
rJMSF032H06+ AATTCTTCAATCTTCCAATCGAAACCCTAGAAA
                      ____________________________________________________________
consensus GACCAATTCTTCAATCTTCCAATCGAAACCCTAGAAA
 
. : . : . : . : . : . :
JMSF032H06- GCTTTTCTCATCAAATTTCTCAGTGCGAAAATGTCAGGCCGTGGAAAGGGAGGCAAGGGC
rJMFF031L16+ GCTTTTCTCATCAAATTTCTCAGTGCGAAAATGTCAGGCCGTGGAAAGGGAGGCAAGGGC
JMFF031L16- GCTTTTCTCATCAAATTTCTCAGTGCGAAAATGTCAGGCCGTGGAAAGGGAGGCAAGGGC
rJMSF032H06+ GCTTTTCTCATCAAATTTCTCAGTGCGAAAATGTCAGGCCGTGGAAAGGGAGGCAAGGGC
                      ____________________________________________________________
consensus GCTTTTCTCATCAAATTTCTCAGTGCGAAAATGTCAGGCCGTGGAAAGGGAGGCAAGGGC
 
. : . : . : . : . : . :
JMSF032H06- TTGGGTAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGACAACATCCAGGGCATC
rJMFF031L16+ TTGGGTAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGACAACATCCAGGGCATC
JMFF031L16- TTGGGTAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGACAACATCCAGGGCATC
rJMSF032H06+ TTGGGTAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGACAACATCCAGGGCATC
                      ____________________________________________________________
consensus TTGGGTAAGGGAGGAGCCAAGCGTCACAGGAAGGTCCTCCGCGACAACATCCAGGGCATC
 
. : . : . : . : . : . :
JMSF032H06- ACCAAGCCCGCCATCCGCCGTCTGGCTCGCAGAGGCGGCGTGAAGCGTATCTCCGGCCTC
rJMFF031L16+ ACCAAGCCCGCCATCCGCCGTCTGGCTCGCAGAGGCGGCGTGAAGCGTATCTCCGGCCTC
JMFF031L16- ACCAAGCCCGCCATCCGCCGTCTGGCTCGCAGAGGCGGCGTGAAGCGTATCTCCGGCCTC
rJMSF032H06+ ACCAAGCCCGCCATCCGCCGTCTGGCTCGCAGAGGCGGCGTGAAGCGTATCTCCGGCCTC
                      ____________________________________________________________
consensus ACCAAGCCCGCCATCCGCCGTCTGGCTCGCAGAGGCGGCGTGAAGCGTATCTCCGGCCTC
 
. : . : . : . : . : . :
JMSF032H06- ATCTACGAGGAGACCAGAGGCGTCCTCAAGATCTTCCTCGAAAACGTGATTAGAGATGCG
rJMFF031L16+ ATCTACGAGGAGACCAGAGGCGTCCTCAAGATCTTCCTCGAAAACGTGATTAGAGATGCG
JMFF031L16- ATCTACGAGGAGACCAGAGGCGTCCTCAAGATCTTCCTCGAAAACGTGATTAGAGATGCG
rJMSF032H06+ ATCTACGAGGAGACCAGAGGCGTCCTCAAGATCTTCCTCGAAAACGTGATTAGAGATGCG
                      ____________________________________________________________
consensus ATCTACGAGGAGACCAGAGGCGTCCTCAAGATCTTCCTCGAAAACGTGATTAGAGATGCG
 
. : . : . : . : . : . :
JMSF032H06- GTGACCTACACGGAGCACGCCCGGAGAAAGACCGTTACGGCGATGGACGTGGTTTACGCG
rJMFF031L16+ GTGACCTACACGGAGCACGCCCGGAGAAAGACCGTTACGGCGATGGACGTGGTTTACGCG
JMFF031L16- GTGACCTACACGGAGCACGCCCGGAGAAAGACCGTTACGGCGATGGACGTGGTTTACGCG
rJMSF032H06+ GTGACCTACACGGAGCACGCCCGGAGAAAGACCGTTACGGCGATGGACGTGGTTTACGCG
                      ____________________________________________________________
consensus GTGACCTACACGGAGCACGCCCGGAGAAAGACCGTTACGGCGATGGACGTGGTTTACGCG
 
. : . : . : . : . : . :
JMSF032H06- CTCAAGAGGCAGGGAAGGACTTTGTACGG
rJMFF031L16+ CTCAAGAGGCAGGGAAGGACTTTGTACGGATTTGGTGGTTAGGAGCTTCATAAACTAGGG
JMFF031L16- CTCAAGAGGCAGGGAAGGACTTTGTACGG
rJMSF032H06+ CTCAAGAGGCAGGGAAGGACTTTGTACGGATTTGGTGGTTAGGAGCTTCATAAACTAGGG
                      ____________________________________________________________
consensus CTCAAGAGGCAGGGAAGGACTTTGTACGGATTTGGTGGTTAGGAGCTTCATAAACTAGGG
 
. : . : . : . : . : . :
rJMFF031L16+ TTTATGCTTCTTTTCTGAAATCAGTGGATTATTTGTGCTTCTGCATTAGTTCTATTT
rJMSF032H06+ TTTATGCTTCTTTTCTGAAATCAGTGGATTATTTGTGCTTCTGCATTAGTTCTATTTACT
                      ____________________________________________________________
consensus TTTATGCTTCTTTTCTGAAATCAGTGGATTATTTGTGCTTCTGCATTAGTTCTATTTACT