Previous Contig 012836:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013P22Sequence322006618 (5)697012836 (4)pir|T45779|T457794e-61probable glutamate receptor - Arabidopsis thaliana>gb:ATF26O13_1550149 Arabidops
JMSF029N09Sequence414006618 (5)715012836 (4)pir|T45779|T457798e-65probable glutamate receptor - Arabidopsis thaliana>gb:ATF26O13_1550149 Arabidops
JMSF032G09Sequence664006618 (5)gb:AY463692_16077784e-46Arabidopsis thaliana GLR3.3 (At1g42540) mRNA, complete cds.744012836 (4)pir|T45779|T457798e-65probable glutamate receptor - Arabidopsis thaliana>gb:ATF26O13_1550149 Arabidops
JMSF046F11Sequence199006618 (5)176012836 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032G09+ TGAAGAACTTGGCATTCACCCATC
                      ____________________________________________________________
consensus TGAAGAACTTGGCATTCACCCATC
 
. : . : . : . : . : . :
rJMSF032G09+ TAGACTCGNTGCTCTTAACCTGCCTGAAGATTATGTCAAGGCTTTAAAGAACGGCCCCAA
                      ____________________________________________________________
consensus TAGACTCGNTGCTCTTAACCTGCCTGAAGATTATGTCAAGGCTTTAAAGAACGGCCCCAA
 
. : . : . : . : . : . :
rJMSF032G09+ AAATGGCGGTGTTATGGCAGTGGTCGATGAACGTGCATACATGGAACTTTTTCTCTCAAC
                      ____________________________________________________________
consensus AAATGGCGGTGTTATGGCAGTGGTCGATGAACGTGCATACATGGAACTTTTTCTCTCAAC
 
. : . : . : . : . : . :
rJMSF013P22+ GCCTT
rJMSF029N09+ GCCTT
rJMSF032G09+ ACATTGCGAGTTCAGTATTGTTGGTCAAGAGTTCCAAAAAAATGGATGGGGATTTGCCTT
                      ____________________________________________________________
consensus ACATTGCGAGTTCAGTATTGTTGGTCAAGAGTTCCAAAAAAATGGATGGGGATTTGCCTT
 
. : . : . : . : . : . :
rJMSF013P22+ CCCGAAGGACTCTCCTCTGGCGGTTGACATGTCAACTGCGATTCTGAAACTGTCAGAAAA
rJMSF029N09+ CCCGAAGGACTCTCCTCTGGCGGTTGACATGTCAACTGCGATTCTGAAACTGTCAGAAAA
rJMSF032G09+ CCCGAAGGACTCTCCTCTGGCGGTTGACATGTCAACTGCGATTCTGAAACTGTCAGAAAA
                      ____________________________________________________________
consensus CCCGAAGGACTCTCCTCTGGCGGTTGACATGTCAACTGCGATTCTGAAACTGTCAGAAAA
 
. : . : . : . : . : . :
rJMSF013P22+ CGGGGAGCTTCAGAGGATCCACGACAAATGGCTGCTGAGGAGCGCCTGTACCTCGCAAAA
rJMSF029N09+ CGGGGAGCTTCAGAGGATCCACGACAAATGGCTGCTGAGGAGCGCCTGTACCTCGCAAAA
rJMSF032G09+ CGGGGAGCTTCAGAGGATCCACGACAAATGGCTGCTGAGGAGCGCCTGTACCTCGCAAAA
                      ____________________________________________________________
consensus CGGGGAGCTTCAGAGGATCCACGACAAATGGCTGCTGAGGAGCGCCTGTACCTCGCAAAA
 
. : . : . : . : . : . :
rJMSF013P22+ CACAAAGCTCGAAGTGGACCGCCTCGAGCTGAAGAGCTTCGCGGGTCTCTTTTCCATATG
rJMSF029N09+ CACAAAGCTCGAAGTGGACCGCCTCGAGCTGAAGAGCTTCGCGGGTCTCTTTTCCATATG
rJMSF032G09+ CACAAAGCTCGAAGTGGACCGCCTCGAGCTGAAGAGCTTCGCGGGTCTCTTTTCCATATG
                      ____________________________________________________________
consensus CACAAAGCTCGAAGTGGACCGCCTCGAGCTGAAGAGCTTCGCGGGTCTCTTTTCCATATG
 
. : . : . : . : . : . :
rJMSF013P22+ CGCGGTGGCGTGCTTCTTAGCTCTGCTCGTGTACTTCATACTGCTGACACGCCAGTTCAC
rJMSF029N09+ CGCGGTGGCGTGCTTCTTAGCTCTGCTCGTGTACTTCATACTGCTGACACGCCAGTTCAC
rJMSF032G09+ CGCGGTGGCGTGCTTCTTAGCTCTGCTCGTGTACTTCATACTGCTGACACGCCAGTTCAC
                      ____________________________________________________________
consensus CGCGGTGGCGTGCTTCTTAGCTCTGCTCGTGTACTTCATACTGCTGACACGCCAGTTCAC
 
. : . : . : . : . : . :
rJMSF013P22+ GAGGTATAGCTCTGATCCCGAGCAGACACCTTCTAGTGGTGGAAGCTCACGATCAGCTCG
rJMSF029N09+ GAGGTATAGCTCTGATCCCGAGCAGACACCTTCTAGTGGTGGAAGCTCACGATCAGCTCG
rJMSF032G09+ GAGGTATAGCTCTGATCCCGAGCAGACACCTTCTAGTGGTGGAAGCTCACGATCAGCTCG
                      ____________________________________________________________
consensus GAGGTATAGCTCTGATCCCGAGCAGACACCTTCTAGTGGTGGAAGCTCACGATCAGCTCG
 
. : . : . : . : . : . :
rJMSF046F11+ TCGACGAAAAAGAAGAGACAGCGAAAAGCCGGTCCAT
rJMSF013P22+ ACTGCAGACTTTCCTCTCTTTTGTCGACGAAAAAGAAGAGACAGCGAAAAGCCGGTCCAT
rJMSF029N09+ ACTGCAGACTTTCCTCTCTTTTGTCGACGAAAAAGAAGAGACAGCGAAAAGCCGGTCCAT
rJMSF032G09+ ACTGCAGACTTTCCTCTCTTTTGTCGACGAAAAAGAAGAGACAGCGAAAAGCCGGTCCAT
                      ____________________________________________________________
consensus ACTGCAGACTTTCCTCTCTTTTGTCGACGAAAAAGAAGAGACAGCGAAAAGCCGGTCCAT
 
. : . : . : . : . : . :
rJMSF046F11+ CAAGAGGAAGCAGATGGAGGGAGATTCAGCTAGNAGCATNGNCGATGATGANTCATANGT
rJMSF013P22+ CAAGAGGAAGCAGATGGAGGGAGATTCAGCTAGGAGCATTGATGATGATGATTCATATGT
rJMSF029N09+ CAAGAGGAAGCAGATGGAGGGAGATTCAGCTAGGAGCATTGATGATGATGATTCATATGT
rJMSF032G09+ CAAGAGGAAGCAGATGGAGGGAGATTCAGCTAGGAGCATTGATGATGATGATTCATATGT
                      ____________________________________________________________
consensus CAAGAGGAAGCAGATGGAGGGAGATTCAGCTAGGAGCATTGATGATGATGATTCATATGT
 
. : . : . : . : . : . :
rJMSF046F11+ GAATGGTTCTTCCAGGAGTATNGGCCATTCACAGGTGTTCTCAAACAGAGCTTAGAGTCT
rJMSF013P22+ GAATGGTTCTTCCAGGAGTATAGGCCATTCACAGGTGTTCTCAAACAGAGCTTAGAGTCT
rJMSF029N09+ GAATGGTTCTTCCAGGAGTATAGGCCATTCACAGGTGTTCTCAAACAGAGCTTAGAGTCT
rJMSF032G09+ GAATGGTTCTTCCAGGAGTATAGGCCGTTCACAGGTGTTCTCAAACAGAGCTTAGAGTCT
                      ____________________________________________________________
consensus GAATGGTTCTTCCAGGAGTATAGGCCATTCACAGGTGTTCTCAAACAGAGCTTAGAGTCT
 
. : . : . : . : . : . :
rJMSF046F11+ TGGAAATTCTCAGTCTGTC
rJMSF013P22+ TGGAAATTCTCAGTCTGTCTTTTTTTAACAATAATTGTGTGCTTCTTAAA
rJMSF029N09+ TGGAAATTCTCAGTCTGTCTTTTTTTAACAATAATTG
rJMSF032G09+ TGGAAATTCTCAGTCTGTCTTTTTTTAACAATAATTGTGTGCTTCTTAAAATGTTATTAT
                      ____________________________________________________________
consensus TGGAAATTCTCAGTCTGTCTTTTTTTAACAATAATTGTGTGCTTCTTAAAATGTTATTAT