Previous Contig 012834:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004G08Sequence398006822 (3)472012834 (2)gb:AP003048_18244502e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P071
JMSF032G04Sequence686006822 (3)gb:ATU16178_15567822e-45Arabidopsis thaliana protein kinase (AFC3) mRNA, partial cds.727012834 (2)gb:AP003048_18244507e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P071

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032G04+ GAGTTCA
                      ____________________________________________________________
consensus GAGTTCA
 
. : . : . : . : . : . :
rJMSF032G04+ GTTGATATGAACTGCAGGTGCNTGCCAAAATCTAGTGCTATTAAGCTGATTGATTTTGGC
                      ____________________________________________________________
consensus GTTGATATGAACTGCAGGTGCNTGCCAAAATCTAGTGCTATTAAGCTGATTGATTTTGGC
 
. : . : . : . : . : . :
rJMSF032G04+ AGTACCGTGTTTGACGATAAGCTTCATAGTTCCATTGTATGCACAAGGCACTACAGAGCA
                      ____________________________________________________________
consensus AGTACCGTGTTTGACGATAAGCTTCATAGTTCCATTGTATGCACAAGGCACTACAGAGCA
 
. : . : . : . : . : . :
rJMSF032G04+ CCAGAGATTATTCTAGGTCTAGGATGGACATATCCCTGTGACCTATGGAGCGTAGGCTGT
                      ____________________________________________________________
consensus CCAGAGATTATTCTAGGTCTAGGATGGACATATCCCTGTGACCTATGGAGCGTAGGCTGT
 
. : . : . : . : . : . :
rJMSF032G04+ ATACTTGTTGAACTTTGCTCGGGTGAAGCTCTTTTTCAGACACACGAGAACTTGGAGCAT
                      ____________________________________________________________
consensus ATACTTGTTGAACTTTGCTCGGGTGAAGCTCTTTTTCAGACACACGAGAACTTGGAGCAT
 
. : . : . : . : . : . :
rJMSF004G08+ CAATGATGGAGAGAGTGTTGGGCCCCCTGCCTCAGCACATGATTCAAAAAGCAAAT
rJMSF032G04+ TTGGCAATGATGGAGAGAGTGTTGGGCCCCCTGCCTCAGCACATGATTCAAAAAGCAAAT
                      ____________________________________________________________
consensus TTGGCAATGATGGAGAGAGTGTTGGGCCCCCTGCCTCAGCACATGATTCAAAAAGCAAAT
 
. : . : . : . : . : . :
rJMSF004G08+ CAAGGTGCAGATAAATATTTCAAGAGATCAAGATTGAATTGGCCTGAAGGTGCAGTATCA
rJMSF032G04+ CAAGGTGCAGATAAATATTTCAAGAGATCAAGATTGAATTGGCCTGAAGGTGCAGTATCA
                      ____________________________________________________________
consensus CAAGGTGCAGATAAATATTTCAAGAGATCAAGATTGAATTGGCCTGAAGGTGCAGTATCA
 
. : . : . : . : . : . :
rJMSF004G08+ AGGGAGAGCATCAGAGCGGTAAACAAGTTGGATCGACTTAAGGATCTTGTATCACGCCAT
rJMSF032G04+ AGGGAGAGCATCAGAGCGGTAAACAAGTTGGATCGACTTAAGGATCTTGTATCACGCCAT
                      ____________________________________________________________
consensus AGGGAGAGCATCAGAGCGGTAAACAAGTTGGATCGACTTAAGGATCTTGTATCACGCCAT
 
. : . : . : . : . : . :
rJMSF004G08+ GTAGAATCCTCAAGATCACCCCTTATCGACTTGTTACAGGGCTTATTGAAGTTCGATCCA
rJMSF032G04+ GTAGAATCCTCAAGATCACCCCTTATCGACTTGTTACAGGGCTTATTGAAGTTCGATCCA
                      ____________________________________________________________
consensus GTAGAATCCTCAAGATCACCCCTTATCGACTTGTTACAGGGCTTATTGAAGTTCGATCCA
 
. : . : . : . : . : . :
rJMSF004G08+ TCTGAGCGACTCACTGCTGAAGAAGCACTTAACCATCCCTTCTTCAGAAATCCAGCCTAA
rJMSF032G04+ TCTGAGCGACTCACTGCTGAAGAAGCACTTAACCATCCCTTCTTCAGAAATCCAGCCTAA
                      ____________________________________________________________
consensus TCTGAGCGACTCACTGCTGAAGAAGCACTTAACCATCCCTTCTTCAGAAATCCAGCCTAA
 
. : . : . : . : . : . :
rJMSF004G08+ CCAAAGTGCTTATTTTGTAATTCCTAATTGATTTTGTTAGAGGCTTCAGCCTGGGATTTT
rJMSF032G04+ CCAAAGTGCTTATTTTGTAATTCCTAATTGATTTTGTTAGAGGCTTCAGCCTGGGATTTT
                      ____________________________________________________________
consensus CCAAAGTGCTTATTTTGTAATTCCTAATTGATTTTGTTAGAGGCTTCAGCCTGGGATTTT
 
. : . : . : . : . : . :
rJMSF004G08+ GATTTTTTATCATGTTCATTTTAAATGTATTGTACATTCATTCGATTGACTTACATGTTT
rJMSF032G04+ GATTTTTTATCATGTTCATTTTAAATGTATTGTACATTCATTCGATTGACTTACATGTTT
                      ____________________________________________________________
consensus GATTTTTTATCATGTTCATTTTAAATGTATTGTACATTCATTCGATTGACTTACATGTTT
 
. : . : . : . : . : . :
rJMSF004G08+ ATTTCAATAATTAGGAACATAATAGGAGACTTCAGAGTTGGTAAGAACCC
rJMSF032G04+ ATTTCAATAATTAGGAACATAATAGGAAACTTCAGAGTTGGTAAGAACCCCAAATTTGTA
                      ____________________________________________________________
consensus ATTTCAATAATTAGGAACATAATAGGAGACTTCAGAGTTGGTAAGAACCCCAAATTTGTA