Previous Contig 012822:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032D10Sequence644012822 (2)gb:AE016959_10232831e-36Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07775012822 (2)gb:AE016959_10232831e-60Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032D10- GCTCGTGTCCACTGATAACCGCCCCAT
                      ____________________________________________________________
consensus GCTCGTGTCCACTGATAACCGCCCCAT
 
. : . : . : . : . : . :
JMSF032D10- TCTCTTTCTCTCTCTGCTTTTTGATGAAGAGGAAGAAGATAGAAGCACTCAGGACTTTCT
                      ____________________________________________________________
consensus TCTCTTTCTCTCTCTGCTTTTTGATGAAGAGGAAGAAGATAGAAGCACTCAGGACTTTCT
 
. : . : . : . : . : . :
JMSF032D10- CTCTTTCTCTCTGTTTCCGAGCGTTATAATCCCAGAAAAATCTCAGAGCTTCTCTGCGAA
                      ____________________________________________________________
consensus CTCTTTCTCTCTGTTTCCGAGCGTTATAATCCCAGAAAAATCTCAGAGCTTCTCTGCGAA
 
. : . : . : . : . : . :
JMSF032D10- AAATATAATTCTTTTTAATGTTAAAATGGGAAATTTGATGTGAAGGGGGTTATGGTGTGT
                      ____________________________________________________________
consensus AAATATAATTCTTTTTAATGTTAAAATGGGAAATTTGATGTGAAGGGGGTTATGGTGTGT
 
. : . : . : . : . : . :
JMSF032D10- AGCTCGGAAGGGAGGTTTTAGGGTGGGTTTAGACAGAGAAAGAAGAGAGTATAGAGGAGA
                      ____________________________________________________________
consensus AGCTCGGAAGGGAGGTTTTAGGGTGGGTTTAGACAGAGAAAGAAGAGAGTATAGAGGAGA
 
. : . : . : . : . : . :
JMSF032D10- GGAGAGGAGAAGAGAAACATGTATATTGGTGGAGGAGGTGGTGGGAGCTTTGGAGGGCAA
                      ____________________________________________________________
consensus GGAGAGGAGAAGAGAAACATGTATATTGGTGGAGGAGGTGGTGGGAGCTTTGGAGGGCAA
 
. : . : . : . : . : . :
JMSF032D10- ATGCGAAGGTCCTTTAAGGATTCTCTCAAAGTTCTTGAAGCTGATATTCAGCACGCGAAT
                      ____________________________________________________________
consensus ATGCGAAGGTCCTTTAAGGATTCTCTCAAAGTTCTTGAAGCTGATATTCAGCACGCGAAT
 
. : . : . : . : . : . :
JMSF032D10- ACTCTGGCATCTGACTTTCCAAGGGAGTATGATGGTGCTTGTCTGCAAATGCGAATGTCA
                      ____________________________________________________________
consensus ACTCTGGCATCTGACTTTCCAAGGGAGTATGATGGTGCTTGTCTGCAAATGCGAATGTCA
 
. : . : . : . : . : . :
JMSF032D10- TACAGCCCCGCGGCACATCTCTTCCTGTTCTTGGTGCAATGGACTGATTGCCAGCTTGCC
                      ____________________________________________________________
consensus TACAGCCCCGCGGCACATCTCTTCCTGTTCTTGGTGCAATGGACTGATTGCCAGCTTGCC
 
. : . : . : . : . : . :
JMSF032D10- GGTACTCTANGATTGTTGAGGATTTTAATCTACNAGGTTTATGTTGATGGCACTACNACN
                      ____________________________________________________________
consensus GGTACTCTANGATTGTTGAGGATTTTAATCTACNAGGTTTATGTTGATGGCACTACNACN
 
. : . : . : . : . : . :
JMSF032D10- ATGTCCACTCNCNAACGAAAGGCNAGCATTAAANAATTTTATGCTGCTATTTATCCCTCC
rJMSF032D10+ AACGAAAGGCCAGCATTAAAGAATTTTATGCTGCTATTTATCCCTCC
                      ____________________________________________________________
consensus ATGTCCACTCNCNAACGAAAGGCCAGCATTAAAGAATTTTATGCTGCTATTTATCCCTCC
 
. : . : . : . : . : . :
JMSF032D10- TTACTTCA
rJMSF032D10+ TTACTTCAACTCGAGAAGGGGGTCACGGATTCGGAAGACAAAAGGCAAAAAGCCGTCTGT
                      ____________________________________________________________
consensus TTACTTCAACTCGAGAAGGGGGTCACGGATTCGGAAGACAAAAGGCAAAAAGCCGTCTGT
 
. : . : . : . : . : . :
rJMSF032D10+ CTGGAGAGGTATAGGAGAAAAGACGATGAGGACTACAGACAAGCTTCGGATTTGGATATT
                      ____________________________________________________________
consensus CTGGAGAGGTATAGGAGAAAAGACGATGAGGACTACAGACAAGCTTCGGATTTGGATATT
 
. : . : . : . : . : . :
rJMSF032D10+ GAGAGGGAGGAAGAATGTGGAATATGCATGGAAATGAACAGCAAAATCGTGCTGCCTAAC
                      ____________________________________________________________
consensus GAGAGGGAGGAAGAATGTGGAATATGCATGGAAATGAACAGCAAAATCGTGCTGCCTAAC
 
. : . : . : . : . : . :
rJMSF032D10+ TGCAATCATGCCATGTGTTTGAAATGCTACCATGAATGGCGTTCAAGGTCACAATCTTGT
                      ____________________________________________________________
consensus TGCAATCATGCCATGTGTTTGAAATGCTACCATGAATGGCGTTCAAGGTCACAATCTTGT
 
. : . : . : . : . : . :
rJMSF032D10+ CCCTTCTGCCGGGATAGTCTGAAAAGCGTGAACTCTGGAGACCTTTGGGTATATCTGGAC
                      ____________________________________________________________
consensus CCCTTCTGCCGGGATAGTCTGAAAAGCGTGAACTCTGGAGACCTTTGGGTATATCTGGAC
 
. : . : . : . : . : . :
rJMSF032D10+ AACCGGGATGCGATGGACATGGAAACTATAACAAGGGAAAACCTGAGAAGGCTGTTCATG
                      ____________________________________________________________
consensus AACCGGGATGCGATGGACATGGAAACTATAACAAGGGAAAACCTGAGAAGGCTGTTCATG
 
. : . : . : . : . : . :
rJMSF032D10+ TACATAGAGAAGCTGCCTCTGATTGTGCCTCATAGCGTTTTTGACACTACTTACGATACT
                      ____________________________________________________________
consensus TACATAGAGAAGCTGCCTCTGATTGTGCCTCATAGCGTTTTTGACACTACTTACGATACT
 
. : . : . : . : . : . :
rJMSF032D10+ CACCTAAGGTAGAGTGGACACAGCCTCTCGGGTTGTCTTCTCGAGCACCATTTTCTCTCA
                      ____________________________________________________________
consensus CACCTAAGGTAGAGTGGACACAGCCTCTCGGGTTGTCTTCTCGAGCACCATTTTCTCTCA
 
. : . : . : . : . : . :
rJMSF032D10+ TTGAATTACTGAAAGGGCCCGAAAAATAAGTCGGTCCGACTAGATTTAGAAAATCTGGAG
                      ____________________________________________________________
consensus TTGAATTACTGAAAGGGCCCGAAAAATAAGTCGGTCCGACTAGATTTAGAAAATCTGGAG
 
. : . : . : . : . : . :
rJMSF032D10+ TGGCTTCTTCTTCCACTTCTGATTATAAGAACCCAGCCTGAGTTATTGTGGCACAGGGTT
                      ____________________________________________________________
consensus TGGCTTCTTCTTCCACTTCTGATTATAAGAACCCAGCCTGAGTTATTGTGGCACAGGGTT
 
. : . : . : . : . : . :
rJMSF032D10+ AGGTTTAAGAACAGTGTTATATTAGTAGTTTCATATCCTAGTATGTACATGCATGTACAG
                      ____________________________________________________________
consensus AGGTTTAAGAACAGTGTTATATTAGTAGTTTCATATCCTAGTATGTACATGCATGTACAG
 
. : . : . : . : . : . :
rJMSF032D10+ TTGTGTTGCTTGGTTGTTTATCAGTGTTTTGGGCCTTCTTAAACTTGGGCTTACCCCATA
                      ____________________________________________________________
consensus TTGTGTTGCTTGGTTGTTTATCAGTGTTTTGGGCCTTCTTAAACTTGGGCTTACCCCATA