Previous Contig 012815:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009D15Sequence228005066 (2)765012815 (2)gb:OSJN00160_16959172e-51Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019G23, complete seque
JMSF032C06Sequence707005066 (2)gb:OSJN00160_16959173e-09Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019G23, complete seque707012815 (2)gb:OSJN00160_16959173e-32Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019G23, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009D15+ TGTGACGGGAAACAACAGAACAAAGAGTGTTTTGCTTGGCCTGCAGG
                      ____________________________________________________________
consensus TGTGACGGGAAACAACAGAACAAAGAGTGTTTTGCTTGGCCTGCAGG
 
. : . : . : . : . : . :
rJMSF009D15+ GTGTTGTCAAGAAGGCTGTTGGGCTTGGTGGTTGG-CACTGGCTGGTTCTGAAGAATGGA
rJMSF032C06+ GGCTGTTGGGCTTGGTGGTTGGNCACTGGCTGGTTCTGAAGAATGGA
                      ____________________________________________________________
consensus GTGTTGTCAAGAAGGCTGTTGGGCTTGGTGGTTGGNCACTGGCTGGTTCTGAAGAATGGA
 
. : . : . : . : . : . :
rJMSF009D15+ GTTGAAGTGAAGCTCCAAAGGAATGCCTTGAGCGTGTTGGAGGCTCCCACTGGGGATGAA
rJMSF032C06+ GTTGAAGTGAAGCTCCAAAGGAATGCCTTGAGCGTGTTGGAGGCTCCCACTGGGGATGAA
                      ____________________________________________________________
consensus GTTGAAGTGAAGCTCCAAAGGAATGCCTTGAGCGTGTTGGAGGCTCCCACTGGGGATGAA
 
. : . : . : . : . : . :
rJMSF009D15+ GATGATGATTATGACTTTGATGACTCTAGCAGTGGTTCTGAAGTTGGTGAAAAGGACAAT
rJMSF032C06+ GATGATGATTATGACTTTGATGACTCTAGCAGTGGTTCTGAAGTTGGTGAAAAGGACAAT
                      ____________________________________________________________
consensus GATGATGATTATGACTTTGATGACTCTAGCAGTGGTTCTGAAGTTGGTGAAAAGGACAAT
 
. : . : . : . : . : . :
rJMSF009D15+ CATCATTTTCCAACTGGCGTTGAGTACAGAAAGGTTAGCAAGCCAAGGGTTCGTTATACA
rJMSF032C06+ CATCATTTTCCAACTGGCGTTGAGTACAGAAAGGTTAGCAAGCCAAGGGTTCGTTATACA
                      ____________________________________________________________
consensus CATCATTTTCCAACTGGCGTTGAGTACAGAAAGGTTAGCAAGCCAAGGGTTCGTTATACA
 
. : . : . : . : . : . :
rJMSF009D15+ AGGCCATGGGCAGCAACAAAATCAAATAGTCGGAGTAGTAGCAAAGATGTTGAAACTAAA
rJMSF032C06+ AGGCCATGGGCAGCAACAAAATCAAATAGTCGGAGTAGTAGCAAAGATGTTGAAACTAAA
                      ____________________________________________________________
consensus AGGCCATGGGCAGCAACAAAATCAAATAGTCGGAGTAGTAGCAAAGATGTTGAAACTAAA
 
. : . : . : . : . : . :
rJMSF009D15+ TATTGCCATCTGTATCAACAGAGAGTGAACTTTGCAAAACTAGGAACCAGCTCATTGTGG
rJMSF032C06+ TATTGCCATCTGTATCAACAGAGAGTGAACTTTGCAAAACTAGGAACCAGCTCATTGTGG
                      ____________________________________________________________
consensus TATTGCCATCTGTATCAACAGAGAGTGAACTTTGCAAAACTAGGAACCAGCTCATTGTGG
 
. : . : . : . : . : . :
rJMSF009D15+ AGATATTGGCGAAGCCACAACCTCGCAAGTATAAGTACTCCCAACCCCACTAAGGATCAA
rJMSF032C06+ AGATATTGGCGAAGCCACAACCTCGCAAGTATAAGTACTCCCAACCCCACTAAGGATCAA
                      ____________________________________________________________
consensus AGATATTGGCGAAGCCACAACCTCGCAAGTATAAGTACTCCCAACCCCACTAAGGATCAA
 
. : . : . : . : . : . :
rJMSF009D15+ TTGGTTAACGCAGTACAACGGCATTTTGCAGCACAGCGGGTTGACGAGGTGCAAGTGGTG
rJMSF032C06+ TTGGTTAACGCAGTACAACGGCATTTTGCAGCACAGCGGGTTGACGAGGTGCAAGTGGTG
                      ____________________________________________________________
consensus TTGGTTAACGCAGTACAACGGCATTTTGCAGCACAGCGGGTTGACGAGGTGCAAGTGGTG
 
. : . : . : . : . : . :
rJMSF009D15+ GTGGAATTCATCCGTGCTGCCAAGAGACTCAGATCAGCTGACCCGCATTGAGATTGATCG
rJMSF032C06+ GTGGAATTCATCCGTGCTGCCAAGAGACTCAGATCAGCTGACCCGCATTGAGATTGATCG
                      ____________________________________________________________
consensus GTGGAATTCATCCGTGCTGCCAAGAGACTCAGATCAGCTGACCCGCATTGAGATTGATCG
 
. : . : . : . : . : . :
rJMSF009D15+ GTGAAAGACTGTGTGTGTTCGGATTTGTAATATATATATCTCTATATATATATAAATATA
rJMSF032C06+ GTGAAAGACTGTGTGTGTTCGGATTTGTAATATATATATCTCTATATATATATAAATATA
                      ____________________________________________________________
consensus GTGAAAGACTGTGTGTGTTCGGATTTGTAATATATATATCTCTATATATATATAAATATA
 
. : . : . : . : . : . :
rJMSF009D15+ TGCATGCATATAACGTATATACATATGAACAACCCTAACTTAGTCCGCTAATTATAAACT
rJMSF032C06+ TGCATGCATATAACGTATATACATATGAACAACCCTAACTTAGTCCGCTAATTATAAACT
                      ____________________________________________________________
consensus TGCATGCATATAACGTATATACATATGAACAACCCTAACTTAGTCCGCTAATTATAAACT
 
. : . : . : . : . : . :
rJMSF009D15+ TACAAATGAAGAGTGGGAGCTTCTTTGTCAGCTCACTCCCACCTCTCTCGGATCCTAAC
rJMSF032C06+ TACAAATGAAGAGTGGGAGCTTCTTTGTCAGCTCACTCCCACCTCTCTCGGATCCTAACC
                      ____________________________________________________________
consensus TACAAATGAAGAGTGGGAGCTTCTTTGTCAGCTCACTCCCACCTCTCTCGGATCCTAACC