Previous Contig 012813:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031L17Sequence558006794 (2)gb:AY059762_15646165e-72Arabidopsis thaliana unknown protein (At3g56120) mRNA, complete cds.>gb:BT004372153012813 (2)
JMSF032B20Sequence670006794 (2)gb:AY059762_15646166e-92Arabidopsis thaliana unknown protein (At3g56120) mRNA, complete cds.>gb:BT004372648012813 (2)gb:AY059762_15646162e-22Arabidopsis thaliana unknown protein (At3g56120) mRNA, complete cds.>gb:BT004372

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032B20+ AATTTCTTGATTCCCTTTAGAGGGCTTGTAAATATGAGAGACTGGAAG
                      ____________________________________________________________
consensus AATTTCTTGATTCCCTTTAGAGGGCTTGTAAATATGAGAGACTGGAAG
 
. : . : . : . : . : . :
rJMSF032B20+ GGATCATTACCTTGGATTCATTGCTATTGCTTTATCCGTTCAACTGAGACAACGGAAGAT
                      ____________________________________________________________
consensus GGATCATTACCTTGGATTCATTGCTATTGCTTTATCCGTTCAACTGAGACAACGGAAGAT
 
. : . : . : . : . : . :
rJMSF032B20+ ATAATATCGAAAGCAGTGTCTGCCTTGAATGCGAATATACGAGATCCAATATTTCACAGG
                      ____________________________________________________________
consensus ATAATATCGAAAGCAGTGTCTGCCTTGAATGCGAATATACGAGATCCAATATTTCACAGG
 
. : . : . : . : . : . :
rJMSF032B20+ GTTAGAGATGTTGCTCCAAACAAGGCAATGTATTGCCTAAGCTTTAAATTACCTGAGGAA
                      ____________________________________________________________
consensus GTTAGAGATGTTGCTCCAAACAAGGCAATGTATTGCCTAAGCTTTAAATTACCTGAGGAA
 
. : . : . : . : . : . :
rJMSF032B20+ ACTTGTAAAATTCATCAAGACTGTCAATAATACTCCTCGATCATAGGGGAGAGAATCTCA
                      ____________________________________________________________
consensus ACTTGTAAAATTCATCAAGACTGTCAATAATACTCCTCGATCATAGGGGAGAGAATCTCA
 
. : . : . : . : . : . :
rJMSF032B20+ AAGCATCTTTGAAATCATGGCCGGAAGAATTACTCCATTATTAGCACTTCTACTGTTCCC
                      ____________________________________________________________
consensus AAGCATCTTTGAAATCATGGCCGGAAGAATTACTCCATTATTAGCACTTCTACTGTTCCC
 
. : . : . : . : . : . :
rJMSF031L17+ CTCGAGTCTNGTAAGCCACCACAGATTTTCGTTCTGAAAGAANTGATAGACGATGG
rJMSF032B20+ TAATCTCGAGTCTTGTAAGCCACCACAGATTTTCGTTCTGAAAGAAATGATAGACGATGG
                      ____________________________________________________________
consensus TAATCTCGAGTCTTGTAAGCCACCACAGATTTTCGTTCTGAAAGAAATGATAGACGATGG
 
. : . : . : . : . : . :
rJMSF031L17+ TCAAGGAATTAGCAGACAAGGGATGTCTGAGGGAATAATCCGCACTCAAAGGATGTCTGA
rJMSF032B20+ TCAAGGAATTAACAGACAAGGGATGTCTGAGGGAATAATCTGCACTCAAAGGATGTCTGA
                      ____________________________________________________________
consensus TCAAGGAATTAGCAGACAAGGGATGTCTGAGGGAATAATCTGCACTCAAAGGATGTCTGA
 
. : . : . : . : . : . :
rJMSF031L17+ AGGANTCATCGGCACGTAAGGTATGTCTTAGGAATTC
rJMSF032B20+ AGGAATCATCGGCACGTAAGGTATGTCTTAGGAATTCCATCAGGTGTGTTGTTGGACAGA
                      ____________________________________________________________
consensus AGGAATCATCGGCACGTAAGGTATGTCTTAGGAATTCCATCAGGTGTGTTGTTGGACAGA
 
. : . : . : . : . : . :
rJMSF032B20+ CAATGAAAGTTGCAAAGATTTGTATTCCTCAGAGATTTGTATTGTCTTTTGTGCTTTATG
                      ____________________________________________________________
consensus CAATGAAAGTTGCAAAGATTTGTATTCCTCAGAGATTTGTATTGTCTTTTGTGCTTTATG
 
. : . : . : . : . : . :
rJMSF032B20+ TGTTTGAGTCTGCATGTACTTCAATATATTCACAGTCAATATTAGATGGGAATGCATTTT
                      ____________________________________________________________
consensus TGTTTGAGTCTGCATGTACTTCAATATATTCACAGTCAATATTAGATGGGAATGCATTTT