Previous Contig 012810:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031P17Sequence649006780 (4)602012810 (4)gb:AP003914_18351380.001Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ15
JMSF036M08Sequence680006780 (4)746012810 (4)gb:AF412052_17973051e-16Arabidopsis thaliana At2g43970/F6E13.10 mRNA, complete cds.
JMSF048M20Sequence675006780 (4)767012810 (4)gb:AF412052_17973054e-09Arabidopsis thaliana At2g43970/F6E13.10 mRNA, complete cds.
JMSF052E05Sequence730006780 (4)967012810 (4)gb:AF412052_17973056e-51Arabidopsis thaliana At2g43970/F6E13.10 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052E05+ AAAGCTTGTAGTT
                      ____________________________________________________________
consensus AAAGCTTGTAGTT
 
. : . : . : . : . : . :
rJMSF052E05+ AGTGAAGATGGAAAAAAGGTCAAACGCCAGNATCCTCTGAGTGAAACAGATATGGAAGAA
                      ____________________________________________________________
consensus AGTGAAGATGGAAAAAAGGTCAAACGCCAGNATCCTCTGAGTGAAACAGATATGGAAGAA
 
. : . : . : . : . : . :
rJMSF052E05+ TTGCAATCTCGCATAATTGTTGCTGAAAACCTGCCTGAGGATCACTGCCACCAGAACCTC
                      ____________________________________________________________
consensus TTGCAATCTCGCATAATTGTTGCTGAAAACCTGCCTGAGGATCACTGCCACCAGAACCTC
 
. : . : . : . : . : . :
rJMSF052E05+ ATGAAGATTTTTTCAACCGTTGGAAGTGTGAAGATGATTCGTACCTGTCAGCCTCAGACT
                      ____________________________________________________________
consensus ATGAAGATTTTTTCAACCGTTGGAAGTGTGAAGATGATTCGTACCTGTCAGCCTCAGACT
 
. : . : . : . : . : . :
rJMSF052E05+ TCCAATGGTGTGTCGTCATCAGGAACTAGAACAGCAAAGTCAGATAGTATGCTCCTCAGC
                      ____________________________________________________________
consensus TCCAATGGTGTGTCGTCATCAGGAACTAGAACAGCAAAGTCAGATAGTATGCTCCTCAGC
 
. : . : . : . : . : . :
rJMSF052E05+ AACAAGTTGCATGCATTTGTCGAATACGAAACTGTTGAATTGGCTGAAAAAGCGGTTGCT
rJMSF036M08+ CATGCATTTGTCGAATACGAAACTGTTGAATTGGCTGAAAAAGCGGTTGCT
rJMSF048M20+ CATGCATTTGTCGNATACGAAACTGTTGAATTGGCTGAAAAAGCGGTTGCT
                      ____________________________________________________________
consensus AACAAGTTGCATGCATTTGTCGAATACGAAACTGTTGAATTGGCTGAAAAAGCGGTTGCT
 
. : . : . : . : . : . :
rJMSF052E05+ GAGCTAAATGATGCGGGTGACTGGAGGAATCTCAAAGTTCGTATACTGGTTAGACGCACT
rJMSF036M08+ GAGCTAAATGATGCGGGTGACTGGAGGAATCTCAAAGTTCGTATACTGGTTAGACGCACT
rJMSF048M20+ GAGCTAAATGATGCGGGTGACTGGAGGAATCTCAAAGTTCGTATACTG------------
                      ____________________________________________________________
consensus GAGCTAAATGATGCGGGTGACTGGAGGAATCTCAAAGTTCGTATACTGGTTAGACGCACT
 
. : . : . : . : . : . :
rJMSF052E05+ GCAAAATTGGCCCATACACGAGGAAAGAAGTTTGGTCATGATAGCGAGTCAAACTTCAAG
rJMSF036M08+ GCAAAATTGGCCCATACACGAGGAAAGAAGTTTGGTCATGATAGCGAGTCAAACTTCAAG
rJMSF048M20+ GCAAAATTGGCCCATACACGAGGAAAGAAGTTTGGTCATGATAGCGAGTCAAACTTCAAG
                      ____________________________________________________________
consensus GCAAAATTGGCCCATACACGAGGAAAGAAGTTTGGTCATGATAGCGAGTCAAACTTCAAG
 
. : . : . : . : . : . :
rJMSF052E05+ GAAGAGGATGCATTTGCCCCCGAGCAGCAACTCTCGTTGCAACATACTGATTCTCAATCT
rJMSF036M08+ GAAGAGGATGCATTTGCCCCCGAGCAGCAACTCTCGTTGCAACATACTGATTCTCAATCT
rJMSF048M20+ GAAGAGGATGCATTTGCCCCCGAGCAGCAACTCTCGTTGCAACATACTGATTCTCAATCT
                      ____________________________________________________________
consensus GAAGAGGATGCATTTGCCCCCGAGCAGCAACTCTCGTTGCAACATACTGATTCTCAATCT
 
. : . : . : . : . : . :
rJMSF052E05+ AATGGGCTTGCAGGAGTGGAAGAAAGTGATAAGGATGGGCCAAGGAGAACACGAAATCGT
rJMSF036M08+ AATGGGCTTGCAGGAGTGGAAGAAAGTGATAAGGATGGGCCAAGGAGAACACGAAATCGT
rJMSF048M20+ AATGGGCTTGCAGGAGTGGAAGAAAGTGATAAGGATGGGCCAAGGAGAACACGAAATCGT
rJMSF031P17+ GT
                      ____________________________________________________________
consensus AATGGGCTTGCAGGAGTGGAAGAAAGTGATAAGGATGGGCCAAGGAGAACACGAAATCGT
 
. : . : . : . : . : . :
rJMSF052E05+ GGCAGTGGCAGGGGCAGGGGACGGCCGACTCCTAACAACAACCGTGGGAGCCTAGGAACT
rJMSF036M08+ GGCAGTGGCAGGGGCAGGGGACGGCCGACTCCTAACAACAACCGTGGGAGCCTAGGAACT
rJMSF048M20+ GGCAGTGGCAGGGGCAGGGGACGGCCGACTCCTAACAACAACCGTGGGAGCCTAGGAACT
rJMSF031P17+ GGCAGTGGCAGGGGCAGGGGACGGCCGACTCCTNACAACAACCGTGGGAGCCTAGGAACT
                      ____________________________________________________________
consensus GGCAGTGGCAGGGGCAGGGGACGGCCGACTCCTAACAACAACCGTGGGAGCCTAGGAACT
 
. : . : . : . : . : . :
rJMSF052E05+ TCTTCAACATCAAATGGCAACCGAGGAAATCATAATGCACCACCTCCAAATCTCTCAGTC
rJMSF036M08+ TCTTCAACATCAAATGGCAACCGAGGAAATCATAATGCACCACCTCCAAATCTCTCAGTC
rJMSF048M20+ TCTTCAACATCAAATGGCAACCGAGGAAATC--AATGCACCACCTCCAAATCTCTCAGTC
rJMSF031P17+ TCTTCAACATCAAATGGCANCCGAGGAAATCATAATGCACCACCTCCAAATNTCTCAGTC
                      ____________________________________________________________
consensus TCTTCAACATCAAATGGCAACCGAGGAAATCATAATGCACCACCTCCAAATCTCTCAGTC
 
. : . : . : . : . : . :
rJMSF052E05+ AATGCTGATCAGGCAACTACAGCCAAGCAACCCTCTGTGCCCCGAATGCCTGATGGCACT
rJMSF036M08+ AATGCTGATCAGGCAACTACAGCCAAGCAACCCTCTGTGCCCCGAATGCCTGATGGCACT
rJMSF048M20+ AATGCTGATCAGGCAACTACAGCCAAGCAACCCTCTGTGCCCCGAATGCCTGATGGCACT
rJMSF031P17+ AATGCTGATCAGGCAACTACAGCCAAGCAACCCTCTGTGCCCCGAATGCNTGATGGCACT
                      ____________________________________________________________
consensus AATGCTGATCAGGCAACTACAGCCAAGCAACCCTCTGTGCCCCGAATGCCTGATGGCACT
 
. : . : . : . : . : . :
rJMSF052E05+ AAGGGATTCTCAATGGGTCGAGGAAAACCAGTCGCTGTGAAAACTGCTTGATGATGGGTT
rJMSF036M08+ AAGGGATTCTCAATGGGTCGAGGAAAACCAGTCGCTGTGAAAACTGCTTGATGATGGGTT
rJMSF048M20+ AAGGGATTCTCAATGGGTCGAGGAAAACCAGTCGCTGTGAAAACTGCTTGATGATGGGTT
rJMSF031P17+ AAGGGATTCTCAATGGGTCGAGGAAAACCAGTCGCTGTGAAAACTGCTTGATGATGGGTT
                      ____________________________________________________________
consensus AAGGGATTCTCAATGGGTCGAGGAAAACCAGTCGCTGTGAAAACTGCTTGATGATGGGTT
 
. : . : . : . : . : . :
rJMSF052E05+ TGCTATTACAACAATAGCATGCATGTCTTGTGGGTGTTAGGCTGGTAATGTCTTCTTTTG
rJMSF036M08+ TGCTATTACAACAATAGCATGCATGTCTTGTGGGTGTTAGGCTGGTAATGTCTTCTTTTG
rJMSF048M20+ TGCTATTACAACAATAGCATGCATGTCTTGTGGGTGTTAGGCTGGTAATGTCTTCTTTTG
rJMSF031P17+ TGCTATTACAACAATAGCATGCATGTCTTGTGGGTGTTAGGCTGGTAATGTCTTCTTTTG
                      ____________________________________________________________
consensus TGCTATTACAACAATAGCATGCATGTCTTGTGGGTGTTAGGCTGGTAATGTCTTCTTTTG
 
. : . : . : . : . : . :
rJMSF052E05+ TGCAGTATTAATGACACGGTTTTACTATTGCTGTCTGTCTAATAGAGCGGGACAGCTGGT
rJMSF036M08+ TGCAGTATTAATGACACGGTTTTACTATTGCTGTCTGTCTAATAGAGCGGGACAGCTGGT
rJMSF048M20+ TGCAGTATTAATGACACGGTTTTACTATTGCTGTCTGTCTAATAGAGCGGGACAGCTGGT
rJMSF031P17+ TGCAGTATTAATGACACGGTTTTACTATTGCTGTCTGTCTAATAGAGCGGGACAGCTGGT
                      ____________________________________________________________
consensus TGCAGTATTAATGACACGGTTTTACTATTGCTGTCTGTCTAATAGAGCGGGACAGCTGGT
 
. : . : . : . : . : . :
rJMSF052E05+ AGTAATGCTATATCGGAGTTAGTTACTGTGTTGCGAGGGGTTGGTAT
rJMSF036M08+ AGTAATGCTATATCGGAGTTAGTTACTGTGTTGCGAGGGGTTGGTATTGAAGAATCTACC
rJMSF048M20+ AGTAATGCTATATCGGAGTTAGTTACTGTGTTGCGAGGGGTTGGTATTGAAGAATCTACC
rJMSF031P17+ AGTAATGCTATATCGGAGTTAGTTACTGTGTTGCGAGGGGTTGGTATTGAAGAATCTACC
                      ____________________________________________________________
consensus AGTAATGCTATATCGGAGTTAGTTACTGTGTTGCGAGGGGTTGGTATTGAAGAATCTACC
 
. : . : . : . : . : . :
rJMSF036M08+ AAGAATGAACATATGCACTTTTCTTTGTTTCGAAC
rJMSF048M20+ AAGAATGAACATATGCACTTTTCTTTGTTTCGAACCCTGTATATTAGAATAAACAGAACC
rJMSF031P17+ AAGAATGAACATATGCACTTTTCTTTGTTTCGAACCCTGTATATTAGAATAAACAGAACC
                      ____________________________________________________________
consensus AAGAATGAACATATGCACTTTTCTTTGTTTCGAACCCTGTATATTAGAATAAACAGAACC
 
. : . : . : . : . : . :
rJMSF048M20+ TGCGGGAT
rJMSF031P17+ TGCGGGATTAACCTACAGCTATACTNGTATGAGTAAAGTTTACATTTTACAGCTGCGTTT
                      ____________________________________________________________
consensus TGCGGGATTAACCTACAGCTATACTNGTATGAGTAAAGTTTACATTTTACAGCTGCGTTT
 
. : . : . : . : . : . :
rJMSF031P17+ GCAACCAAAGTNTCCATCTATCATNGGAATCAAATAAAAATGCTAACGTCTAGTCTGTTC
                      ____________________________________________________________
consensus GCAACCAAAGTNTCCATCTATCATNGGAATCAAATAAAAATGCTAACGTCTAGTCTGTTC