Previous Contig 012800:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031M06Sequence161012800 (2)
JMSF031N06Sequence228006768 (2)649012800 (2)gb:BT014978_16419482e-45Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031N06+ GTAAGATACATTGTTTCTTCCCTCAAAATGTGGTTTCAGACATTAAGAC
                      ____________________________________________________________
consensus GTAAGATACATTGTTTCTTCCCTCAAAATGTGGTTTCAGACATTAAGAC
 
. : . : . : . : . : . :
rJMSF031N06+ ACCACTGTTCCTAATAAATTCAGCCTATGATCATTGGCAGGTTAGAAATGCCTTGATTCC
                      ____________________________________________________________
consensus ACCACTGTTCCTAATAAATTCAGCCTATGATCATTGGCAGGTTAGAAATGCCTTGATTCC
 
. : . : . : . : . : . :
rJMSF031N06+ TGCCGTCGCCGATCCCTCCGGGGAGTGGAACAAGTGCAAGGCCGACATAGTTAATTGTCT
                      ____________________________________________________________
consensus TGCCGTCGCCGATCCCTCCGGGGAGTGGAACAAGTGCAAGGCCGACATAGTTAATTGTCT
 
. : . : . : . : . : . :
rJMSF031N06+ GCCTAACCAACTCAAAACTCTCCAAGAGTATAGGTTGGAGTTTTTAAAAGCATTCAACGG
                      ____________________________________________________________
consensus GCCTAACCAACTCAAAACTCTCCAAGAGTATAGGTTGGAGTTTTTAAAAGCATTCAACGG
 
. : . : . : . : . : . :
rJMSF031N06+ ATTAGAACCTTCCAAGGAAAGAGGGTACTTTATCGACTCTTGCTATCTACACTGTCAGAC
                      ____________________________________________________________
consensus ATTAGAACCTTCCAAGGAAAGAGGGTACTTTATCGACTCTTGCTATCTACACTGTCAGAC
 
. : . : . : . : . : . :
rJMSF031M06+ TAACAAGACGGTGGN
rJMSF031N06+ TGAACTGCAGATGTTTTGGCACATGCATAATTCTACGAGGTTGTCTAACAAGACGGTGGC
                      ____________________________________________________________
consensus TGAACTGCAGATGTTTTGGCACATGCATAATTCTACGAGGTTGTCTAACAAGACGGTGGC
 
. : . : . : . : . : . :
rJMSF031M06+ GCAAGCGGCGGCGGATNGGTTNNTCNNCAGAGNTTTGTTTCGGANGATAGATTNCCCTTA
rJMSF031N06+ GCAAGCGGCGGCGGATTGGTTTTTCAACAGAGATTTGTTTCGGAAGATAGATTGCCCTTA
                      ____________________________________________________________
consensus GCAAGCGGCGGCGGATTGGTTTTTCAACAGAGATTTGTTTCGGAAGATAGATTGCCCTTA
 
. : . : . : . : . : . :
rJMSF031M06+ TCCNTNCAACAAAAGTTGCGCCAAATCGGCC
rJMSF031N06+ TCCCTGCAACAAAAGTTGCACCAAAACGGCCACTTTATTATTGGACGACCGTGATCTATG
                      ____________________________________________________________
consensus TCCCTGCAACAAAAGTTGCGCCAAATCGGCCACTTTATTATTGGACGACCGTGATCTATG
 
. : . : . : . : . : . :
rJMSF031N06+ ATCCAATATAATCATATTTTCTTCATAATTTTATACAAACATATAGAAGGAAAAGTAGTG
                      ____________________________________________________________
consensus ATCCAATATAATCATATTTTCTTCATAATTTTATACAAACATATAGAAGGAAAAGTAGTG
 
. : . : . : . : . : . :
rJMSF031N06+ CTACAAATAAATGGGGGAATAATATTTTCTAAATTGAAAAGGAAATAGGAAAATGGGTAT
                      ____________________________________________________________
consensus CTACAAATAAATGGGGGAATAATATTTTCTAAATTGAAAAGGAAATAGGAAAATGGGTAT
 
. : . : . : . : . : . :
rJMSF031N06+ AGGGAAACTAGATAGACAACCAGTGGAATAGATTATACCAGGTTTTTGAGTATATAGCTT
                      ____________________________________________________________
consensus AGGGAAACTAGATAGACAACCAGTGGAATAGATTATACCAGGTTTTTGAGTATATAGCTT