Previous Contig 012791:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020A17Sequence573012791 (6)gb:AY088079_15731032e-23Arabidopsis thaliana clone 40987 mRNA, complete sequence.746012791 (6)sp|Q93ZE8|SDF2_ARATH1e-83Stromal cell-derived factor 2-like protein precursor (SDF2-like protein).>gb:AY0
JMSF031K08Sequence627012791 (6)gb:AP004702_18436497e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P052741012791 (6)pir|D84644|D846442e-78hypothetical protein At2g25110 [imported] - Arabidopsis thaliana
JMSF049K19Sequence726012791 (6)gb:AY088079_15731035e-49Arabidopsis thaliana clone 40987 mRNA, complete sequence.713012791 (6)pir|D84644|D846443e-72hypothetical protein At2g25110 [imported] - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049K19- GAAG
                      ____________________________________________________________
consensus GAAG
 
. : . : . : . : . : . :
JMSF031K08- ACCGATCAATATTGACGAAAGACGAAACATTAGATAGGGTGAAGCCATCACCGGAAA
JMFF020A17- ACCGATCAATATTGACGAAAGACGAAACATTAGATAGGGTGAAGCCATCACCGGAAA
JMSF049K19- ACCACCGATCAATATTGACGAAAGACGAAACATTAGATAGGGTGAAGCCATCACCGGAAA
                      ____________________________________________________________
consensus ACCACCGATCAATATTGACGAAAGACGAAACATTAGATAGGGTGAAGCCATCACCGGAAA
 
. : . : . : . : . : . :
JMSF031K08- ACCCGACTCACAACCGGACCGTTGTCGGATCTCCACCGGAAATCCGCCAATAACTTCCAC
JMFF020A17- ACCCGACTCACAACCGGACCGTTGTCGGATCTCCACCGGAAATCCGCCAATAACTTCCAC
JMSF049K19- ACCCGACTCACAACCGGACCGTTGTCGGATCTCCACCGGAAATCCGCCAATAACTTCCAC
                      ____________________________________________________________
consensus ACCCGACTCACAACCGGACCGTTGTCGGATCTCCACCGGAAATCCGCCAATAACTTCCAC
 
. : . : . : . : . : . :
JMSF031K08- CGTGGCTCCATCAGGCCCGCAAAAGCAGCAGCAGCATCAAAATCTCACCCGCAGAAAGTC
JMFF020A17- CGTGGCTCCATCAGGCCCGCAAAAGCAGCAGCAGCATCAAAATCTCACCCGCAGAAAGTC
JMSF049K19- CGTGGCTCCATCAGGCCCGCAAAAGCAGCAGCAGCATCAAAATCTCACCCGCAGAAAGTC
                      ____________________________________________________________
consensus CGTGGCTCCATCAGGCCCGCAAAAGCAGCAGCAGCATCAAAATCTCACCCGCAGAAAGTC
 
. : . : . : . : . : . :
JMSF031K08- GGCACCGCCGTCTACATTCTCGAGTCAACCATCTTCCAGCCCGACCCGGATAGTGTACCG
JMFF020A17- GGCACCGCCGTCTACATTCTCGAGTCAACCATCTTCCAGCCCGACCCGGATAGTGTACCG
JMSF049K19- GGCACCGCCGTCTACATTCTCGAGTCAACCATCTTCCAGCCCGACCCGGATAGTGTACCG
                      ____________________________________________________________
consensus GGCACCGCCGTCTACATTCTCGAGTCAACCATCTTCCAGCCCGACCCGGATAGTGTACCG
 
. : . : . : . : . : . :
JMSF031K08- CGAAGCCGCTTTGTCTGAAACCCTGCCGTTTTGGCAAAGTACTTGGTTCATAGTGCTGCT
JMFF020A17- CGAAGCCGCTTTGTCTGAAACCCTGCCGTTTTGGCAAAGTACTTGGTTCATAGTGCTGCT
JMSF049K19- CGAAGCCGCTTTGTCTGAAACCCTGCCGTTTTGGCAAAGTACTTGGTTCATAGTGCTGCT
                      ____________________________________________________________
consensus CGAAGCCGCTTTGTCTGAAACCCTGCCGTTTTGGCAAAGTACTTGGTTCATAGTGCTGCT
 
. : . : . : . : . : . :
JMSF031K08- GCTATTGATGGCGCTCTCTCTCTTCGCTCTCGCCATCTTTCTCTTCCTTAACCTCGACGC
JMFF020A17- GCTATTGATGGCGCTCTCTCTCTTCGCTCTCGCCATCTTTCTCTTCCTTAACCTCGACGC
JMSF049K19- GCTATTGATGGCGCTCTCTCTCTTCGCTCTCGCCATCTTTCTCTTCCTTAACCTCAACGC
                      ____________________________________________________________
consensus GCTATTGATGGCGCTCTCTCTCTTCGCTCTCGCCATCTTTCTCTTCCTTAACCTCGACGC
 
. : . : . : . : . : . :
JMSF031K08- CGATTTCAGCTCAACCCCTGTATCCGCTGCTTCTGAAGGTGTTCAGATTTCTTATGGGTC
JMFF020A17- CGATTTCAGCTCAACCCCTGTATCCGCTGCTTCTGAAGGTGTTCAGATTTCTTATGGGTC
JMSF049K19- CGATTTCAGCTCAACCCCTGTATCCGCTGCTTCTGAAGGTGTTCAGATTTCTTATGGGTC
rJMFF020A17+ TGTTCAGATTTCTTATGGGTC
                      ____________________________________________________________
consensus CGATTTCAGCTCAACCCCTGTATCCGCTGCTTCTGAAGGTGTTCAGATTTCTTATGGGTC
 
. : . : . : . : . : . :
JMSF031K08- AGCAATCAAGTTGATGCATGAGAGGACTAAGTT-CCGGTTGCATTCACACGATGTGCCTT
JMFF020A17- AGCAATCAAGTTGATGCATGAGAGGACTAAGTT-CCGGTTGCATTCACACGATGTGCCTT
JMSF049K19- AGCAATCAAGTTGATGCATGAGAGGACTAAGTT-CCGGTTGCATTCACACGATGTGCCTT
rJMFF020A17+ AGCAATCAAGTTGATGCATGAGAGGACTAAGTTCCCGGTTGCATTCACACGATGTGCCTT
rJMSF031K08+ TGCATTCACACGATGTGCCTT
                      ____________________________________________________________
consensus AGCAATCAAGTTGATGCATGAGAGGACTAAGTT-CCGGTTGCATTCACACGATGTGCCTT
 
. : . : . : . : . : . :
JMSF031K08- ATGGTTCTGGCAGCGGGCAGCAGTCAGTCACGGGTTTTCCTGGTGTAGATGATGCTAACA
JMFF020A17- ATGGTTCTGGCAGCGGGCAGCAGTCAGTCACGGGTTTTCCTGGTGTAGATGATGCTAACA
JMSF049K19- ATGGTTCTGGCAGCGGGCAGCAGTCAGTCACGGGTTTTCCTGGTGTAGATGATGCTAACA
rJMFF020A17+ ATGGTTCTGGCAGCGGGCAGCAGTCAGTCACGGGTTTTCCTGGTGTAGATGATGCTAACA
rJMSF049K19+ TGGCAGCGGGCAGCAGTCAGTCACGGGTTTTCCTGGTGTAGATGATGCTAACA
rJMSF031K08+ ATGGTTCTGGCAGCGGGCAGCAGTCAGTCACGGGTTTTCCTGGTGTAGATGATGCTAACA
                      ____________________________________________________________
consensus ATGGTTCTGGCAGCGGGCAGCAGTCAGTCACGGGTTTTCCTGGTGTAGATGATGCTAACA
 
. : . : . : . : . : . :
JMSF031K08- GCTACTGGATTGTTAGGTCAGTTCTGGACTCACCTGCAAAGCAAGGTGATGCTATTAAAG
JMFF020A17- GCTACTGGATTGTTAGGTCAGTTCTGGACTC
JMSF049K19- GCTACTGGATTGTTAGGTCAGTTCTGGACTCACCTGCAAAGCAAGGTGATGCTATTAAAG
rJMFF020A17+ GCTACTGGATTGTTAGGTCAGTTCTGGACTCACCTGCAAAGCAAGGTGATGCTATTAAAG
rJMSF049K19+ GCTACTGGATTGTTAGGTCAGTTCTGGACTCACCTGCAAAGCAAGGTGATGCTATTAAAG
rJMSF031K08+ GCTACTGGATTGTTAGGTCAGTTCTGGACTCACCTGCAAAGCAAGGTGATGCTATTAAAG
                      ____________________________________________________________
consensus GCTACTGGATTGTTAGGTCAGTTCTGGACTCACCTGCAAAGCAAGGTGATGCTATTAAAG
 
. : . : . : . : . : . :
JMSF031K08- CAGGAAGTATTATCAGACTTCAGCATATGA
JMSF049K19- CAGGAAGTATTATCAGACTTCAGCATATGAGGACAAGGAGATGGCTGCACAGTCACCTTC
rJMFF020A17+ CAGGAAGTATTATCAGACTTCAGCATATGAGGACAAGGAGATGGCTGCACAGTCACCTTC
rJMSF049K19+ CAGGAAGTATTATCAGACTTCAGCATATGAGGACAAGGAGATGGCTGCACAGTCACCTTC
rJMSF031K08+ CAGGAAGTATTATCAGACTTCAGCATATGAGGACAAGGAGATGGCTGCACAGTCACCTTC
                      ____________________________________________________________
consensus CAGGAAGTATTATCAGACTTCAGCATATGAGGACAAGGAGATGGCTGCACAGTCACCTTC
 
. : . : . : . : . : . :
JMSF049K19- ATGCATCTCCCATATCTGGCANTCTGGAGGTTAGCTGCTTTGGTGATGACAATAATTCTG
rJMFF020A17+ ATGCATCTCCCATATCTGGCAATCTGGAGGTTAGCTGCTTTGGTGATGACAATAATTCTG
rJMSF049K19+ ATGCATCTCCCATATCTGGCAATCTGGAGGTTAGCTGCTTTGGTGATGACAATAATTCTG
rJMSF031K08+ ATGCATCTCCCATATCTGGCAATCTGGAGGTTAGCTGCTTTGGTGATGACAATAATTCTG
                      ____________________________________________________________
consensus ATGCATCTCCCATATCTGGCAATCTGGAGGTTAGCTGCTTTGGTGATGACAATAATTCTG
 
. : . : . : . : . : . :
JMSF049K19- ATA
rJMFF020A17+ ATACTGGGGACTACTGGAAACTTGAAATTGAAGGAAATGGGAAAACTTGGAGGCAAGATC
rJMSF049K19+ ATACTGGGGACTACTGGAAACTTGAAATTGAAGGAAATGGGAAAACTTGGAGGCAAGATC
rJMSF031K08+ ATACTGGGGACTACTGGAAACTTGAAATTGAAGGAAATGGGAAAACTTGGAGGCAAGATC
                      ____________________________________________________________
consensus ATACTGGGGACTACTGGAAACTTGAAATTGAAGGAAATGGGAAAACTTGGAGGCAAGATC
 
. : . : . : . : . : . :
rJMFF020A17+ AAAGGATCAGGCTTCGCCATGTGGACACTGCAGGGTATCTACACAGTCATGACAAGAAGT
rJMSF049K19+ AAAGGATCAGGCTTCGCCATGTGGACACTGCAGGGTATCTACACAGTCATGACAAGAAGT
rJMSF031K08+ AAAGGATCAGGCTTCGCCATGTGGACACTGCAGGGTATCTACACAGTCATGACAAGAAGT
                      ____________________________________________________________
consensus AAAGGATCAGGCTTCGCCATGTGGACACTGCAGGGTATCTACACAGTCATGACAAGAAGT
 
. : . : . : . : . : . :
rJMFF020A17+ ACACCCGCATTGCTGGGGGCCAGCAAGAGGTTTGTGGCGTAAGAGAGAAGCGTCCTGATA
rJMSF049K19+ ACACCCGCATTGCTGGGGGCCAGCAAGAGGTTTGTGGCGTAAGAGAGAAGCGTCCTGATA
rJMSF031K08+ ACACCCGCATTGCTGGGGGCCAGCAAGAGGTTTGTGGCGTAAGAGAGAAGCGTCCTGATA
                      ____________________________________________________________
consensus ACACCCGCATTGCTGGGGGCCAGCAAGAGGTTTGTGGCGTAAGAGAGAAGCGTCCTGATA
 
. : . : . : . : . : . :
rJMFF020A17+ ATGTTTGGCTGGC
rJMSF049K19+ ATGTTTGGCTGGCTGCAGAAGGGGTATATCTCCCAGTTACTACCGAAAGCAAGTAATGAA
rJMSF031K08+ ATGTTTGGCTGGCTGCAGAAGGGGTATATCTCCCAGTTACTACCGAAAGCAAGTAATGAA
                      ____________________________________________________________
consensus ATGTTTGGCTGGCTGCAGAAGGGGTATATCTCCCAGTTACTACCGAAAGCAAGTAATGAA
 
. : . : . : . : . : . :
rJMSF049K19+ TACGATATTGTGTTAGTGTGATTGAAAGCTACTGCATAACTTTTACCCTTTAGTAATATC
rJMSF031K08+ TACGATATTGTGTTAGTGTGATTGAAAGCTACTGCATAACTTTTACCCTTTAGTAATATC
                      ____________________________________________________________
consensus TACGATATTGTGTTAGTGTGATTGAAAGCTACTGCATAACTTTTACCCTTTAGTAATATC
 
. : . : . : . : . : . :
rJMSF049K19+ TTCTTCCATTCCAAAAGAGGGCATAGGATGTTTTGTGCTATTTCCCTTTTGCTGCTCTTC
rJMSF031K08+ TTCTTCCATTCCAAAAGAGGGCATAGGATGTTTTGTGCTATTTCCCTTTTGCTGCTCTTC
                      ____________________________________________________________
consensus TTCTTCCATTCCAAAAGAGGGCATAGGATGTTTTGTGCTATTTCCCTTTTGCTGCTCTTC
 
. : . : . : . : . : . :
rJMSF049K19+ TGAGAGATTTTCAACCACTTATCAACTTCACATTATCATAAATGTTAAGGCAGGCTTAAA
rJMSF031K08+ TGAGAGATTTTCAACCACTTATCAACTTCACATTATCATAAATGTTAAGGCAGGCTTAAA
                      ____________________________________________________________
consensus TGAGAGATTTTCAACCACTTATCAACTTCACATTATCATAAATGTTAAGGCAGGCTTAAA
 
. : . : . : . : . : . :
rJMSF049K19+ CTTATAGAGTAGGACTCTTTATCAAAAATTGTTTCTGCTCATCATATACCAGTATGCACC
rJMSF031K08+ CTTATAGAGTAGGACTCCTTATCAAAAATTGTTTCTGCTCATCATATACCAGTATGCACC
                      ____________________________________________________________
consensus CTTATAGAGTAGGACTCTTTATCAAAAATTGTTTCTGCTCATCATATACCAGTATGCACC