Previous Contig 012790:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003P08Sequence108012790 (8)744008299 (2)pir|T45830|T458302e-25hypothetical protein F2K15.110 - Arabidopsis thaliana>gb:ATF2K15_1550531 Arabido
JMFF019P12Sequence320001004 (2)gb:AC115592_12057400.005Dictyostelium discoideum chromosome 2 map 1-125959 strain AX4, complete sequence742012790 (8)gb:BT015918_16425363e-53Arabidopsis thaliana At5g10650 gene, complete cds.>gb:BT020582_1642976 Arabidops
JMFN040F17Sequence539012790 (8)gb:AP005412_18513724e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFN043H18Sequence291012790 (8)gb:AP003771_18333622e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P062
JMFS126D02Sequence516012790 (8)
JMSF019I10Sequence573019122gb:BT015918_16425368e-07Arabidopsis thaliana At5g10650 gene, complete cds.>gb:BT020582_1642976 Arabidops757012790 (8)gb:BT015918_16425363e-53Arabidopsis thaliana At5g10650 gene, complete cds.>gb:BT020582_1642976 Arabidops
JMSF022B18Sequence601012790 (8)gb:AY049288_15619308e-11Arabidopsis thaliana AT3g49250/F2K15_110 mRNA, complete cds.>gb:AY090286_1574038762008299 (2)pir|T45830|T458302e-39hypothetical protein F2K15.110 - Arabidopsis thaliana>gb:ATF2K15_1550531 Arabido
JMSF031J24Sequence667019677sp|Q9NQV7|PRD9_HUMAN0.029PR-domain zinc finger protein 9.>gb:AF275816_1894355 Homo sapiens PR-domain cont762012790 (8)gb:BT015918_16425363e-56Arabidopsis thaliana At5g10650 gene, complete cds.>gb:BT020582_1642976 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022B18+ CTCATAATCTGTTTAACTGTCTCCTCCTCACTCC
                      ____________________________________________________________
consensus CTCATAATCTGTTTAACTGTCTCCTCCTCACTCC
 
. : . : . : . : . : . :
JMSF022B18+ GAGCATCTTGATCATTTTCAATTTTAGGTGCAGCTGCTGAGTGATGTTTGCCAAGTGCAA
                      ____________________________________________________________
consensus GAGCATCTTGATCATTTTCAATTTTAGGTGCAGCTGCTGAGTGATGTTTGCCAAGTGCAA
 
. : . : . : . : . : . :
JMSF022B18+ CTTGCAGATCTATAATTGAATCATCCAATCTGTTCTTCTTTGTCTTTAAGAATTTCATAT
                      ____________________________________________________________
consensus CTTGCAGATCTATAATTGAATCATCCAATCTGTTCTTCTTTGTCTTTAAGAATTTCATAT
 
. : . : . : . : . : . :
JMSF022B18+ TTTCTTCATGTTGTTTGACTCTCAGACCAGTCTCCTGTAAAGCATCCTGACATATCTTCG
                      ____________________________________________________________
consensus TTTCTTCATGTTGTTTGACTCTCAGACCAGTCTCCTGTAAAGCATCCTGACATATCTTCG
 
. : . : . : . : . : . :
JMSF022B18+ CTTTGTAAGCAGGTGAGTCTAAAATTCCATTTTGCATTCCCTGGTTTGCAAATGCAGAGG
                      ____________________________________________________________
consensus CTTTGTAAGCAGGTGAGTCTAAAATTCCATTTTGCATTCCCTGGTTTGCAAATGCAGAGG
 
. : . : . : . : . : . :
JMSF022B18+ AATTGTTCTGACCCACATGGTTCAACATTGATGTATCGTGAACAACAAGTGCCTTTGCAT
                      ____________________________________________________________
consensus AATTGTTCTGACCCACATGGTTCAACATTGATGTATCGTGAACAACAAGTGCCTTTGCAT
 
. : . : . : . : . : . :
JMSF022B18+ TGTTTGCCATCTGAAATTGCTCGTCGCCAATCATCGCCAGCAGCTCTATCACCAGCAGCT
                      ____________________________________________________________
consensus TGTTTGCCATCTGAAATTGCTCGTCGCCAATCATCGCCAGCAGCTCTATCACCAGCAGCT
 
. : . : . : . : . : . :
JMSF022B18+ CTTCGAAATGGAGGAGGAAATCGGGACTGAGCGCACGTGAGATTGGGGGAGATGCTGAAA
                      ____________________________________________________________
consensus CTTCGAAATGGAGGAGGAAATCGGGACTGAGCGCACGTGAGATTGGGGGAGATGCTGAAA
 
. : . : . : . : . : . :
JMFF003P08+ GTGAAAAGTGACGACAAGTGAGAGCTTTCGGTTCTGTACGATTCGTGCGGACGGCGTCG
JMSF022B18+ TGTGAAAAGTGACGACAAGTGAGAGCTTTCGGTTCTGTACGATTCGTGCGGACGGCGTCG
JMFS126D02- GTGAAAAGTGACGACAAGTGAGAGCTTTCGGTTCTGTACGATTCGTGCGGACGGCGTCG
                      ____________________________________________________________
consensus TGTGAAAAGTGACGACAAGTGAGAGCTTTCGGTTCTGTACGATTCGTGCGGACGGCGTCG
 
. : . : . : . : . : . :
JMFF003P08+ TTGGCGACGGCAGACTGGCAGTGGAGGGTCGGCTCACGAGTCAC
JMSF022B18+ TTGGCGACGGCAGACTGGCAGTGGAGGGTCGGCTCACGAGTCACGGCTGGGAGATTGGAG
JMFS126D02- TTGGCGACGGCAGACTGGCAGTGGAGGGTCGGCTCACGAGTCACGGCTGGGAGATTGGAG
                      ____________________________________________________________
consensus TTGGCGACGGCAGACTGGCAGTGGAGGGTCGGCTCACGAGTCACGGCTGGGAGATTGGAG
 
. : . : . : . : . : . :
JMSF022B18+ AGAGAGGAG
JMFS126D02- AGAGAGGAGCCTCGTGCCGAATTCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus AGAGAGGAGCCTCGTGCCGAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFS126D02- XXXXXXXXXXXXXXXXXXXXXXCTCTCTGGACATTGAAATGTCACATTAAAACCAACTGA
JMFN040F17+ CTCTCTGTACATTGAAATGTCACATTAAAACCAACTGA
rJMSF019I10- CTCTCTGTACATTGAAACGTCACATTAAAACCAACTGA
rJMFF019P12- GAAATGTCACATTAAAACCAACTGA
rJMSF031J24- TTAAAACCAACTGA
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNCTCTCTGTACATTGAAATGTCACATTAAAACCAACTGA
 
. : . : . : . : . : . :
JMFS126D02- AACTTTAAAACTTCACACCACAAAGCAACTTTCAGCCTGGGCTTCAATGGTTAATATCAT
JMFN040F17+ AACTTTAAAACTTCACACCACAAAGCAACTTTCAGCCTGGGCTTCAATGGTTAATATCAT
rJMSF019I10- AACTTTAAAACTTCACACCACAAAGCAACTTTCAGCCTGGGCTTCAATGGTTAATATCAT
rJMFF019P12- AACTTTAAAACTTCACACCACAAAGCAACTTTCAGCCTGGGCTTCAATGGTTAATATCAT
rJMSF031J24- AACTTTAAAACTTCACACCACAAAGCAACTTTCAGCCTGGGCTTCAATGGTTAATATCAT
                      ____________________________________________________________
consensus AACTTTAAAACTTCACACCACAAAGCAACTTTCAGCCTGGGCTTCAATGGTTAATATCAT
 
. : . : . : . : . : . :
JMFS126D02- CACTGCTAAGACTACTCTTCATCTTATTCAAATCAAAAACATGTAAAAGGATGTTTTTTG
JMFN040F17+ CACTGCTAAGACTACTCTTCATCTTATTCAAATCAAAAACATGTAAAAGGATGTTTTTTG
rJMSF019I10- CACTGCTAAGACTACTCTTCATCTTATTCAAATCAAAAACATGTAAAAGGATGTTTTTTG
rJMFF019P12- CACTGCTAAGACTACTCTTCATCTTATTCAAATCAAAAACATGTAAAAGGATGTTTTTTG
rJMSF031J24- CACTGCTAAGACTACTCTTCATCTTATTCAAATCAAAAACATGTAAAAGGATGTTTTTTG
                      ____________________________________________________________
consensus CACTGCTAAGACTACTCTTCATCTTATTCAAATCAAAAACATGTAAAAGGATGTTTTTTG
 
. : . : . : . : . : . :
JMFS126D02- AG-AAAAAAACAGAAGGGGATCTGTACAAGAGGAAACCAAATCCATTCCCTCAAAATCGT
JMFN040F17+ AGAAAAAAAACAGAAGGGGATCTGTACAAGAGGAAACCAAATCCATTCCCTCAGAATCGT
rJMSF019I10- AG-AAAAAAACAGAAGGGGATCTGTACAAGAGGAAACCAAATCCATTCCCTCAGAATCGT
rJMFF019P12- AG-AAAAAAACAGAAGGGGATCTGTACAAGAGGAAACCAAATCCATTCCCTCAGAATCGT
rJMSF031J24- AG-AAAAAAACAGAAGGGGATCTGTACAAGAGGAAACCAAATCCATTCCCTCAGAATCGT
                      ____________________________________________________________
consensus AG-AAAAAAACAGAAGGGGATCTGTACAAGAGGAAACCAAATCCATTCCCTCAGAATCGT
 
. : . : . : . : . : . :
JMFS126D02- GGTAGGCACTGATCGAGGTTGCTTGAAAAGAATTACAAGGGCGAAGAGGGCCGAGATGGA
JMFN040F17+ GGTAGGCACTGATCGAGGTTGCTTGAAAAGAATTACAAGGGCGAAGAGGGCCGAGATGGA
rJMSF019I10- GGTAGGCACTGATCGAGGTTGCTTGAAAAGAATTACAAGGGCGAAGAGGGCCGAGATGGA
rJMFF019P12- GGTAGGCACTGATCGAGGTTGCTTGAAAAGAATTACAAGGGCGAAGAGGGCCGAGATGGA
rJMSF031J24- GGTAGGCACTGATCGAGGTTGCTTGAAAAGAATTACAAGGGCGAAGAGGGCCGAGATGGA
                      ____________________________________________________________
consensus GGTAGGCACTGATCGAGGTTGCTTGAAAAGAATTACAAGGGCGAAGAGGGCCGAGATGGA
 
. : . : . : . : . : . :
JMFS126D02- ACAGCAGAAGCCTTGCAGATAGGGCACCAATTCTTCAT
JMFN040F17+ ACAGCAGAAGCCTTGCAGATAGGGCACCAATTCTTCATCCTTAACCACTGATGAACGCAC
rJMSF019I10- ACAGCAGAAGCCTTGCAGATAGGGCACCAATTCTTCATCCTTAACCACTGATGAACGCAC
rJMFF019P12- ACAGCAGAAGCCTTGCAGATAGGGCACCAATTCTTCATCCTTAACCACTGATGAACGCAC
rJMSF031J24- ACAGCAGAAGCCTTGCAGATAGGGCACCAATTCTTCATCCTTAACCACTGATGAACGCAC
                      ____________________________________________________________
consensus ACAGCAGAAGCCTTGCAGATAGGGCACCAATTCTTCATCCTTAACCACTGATGAACGCAC
 
. : . : . : . : . : . :
JMFN040F17+ GCCAAATGGTATCCATGTTCGCATCCCAACATCC
rJMSF019I10- GCCAAATGGTATCCATGTTCGCATCCCAACATCCCCATCTCATCCCCGAGCACATACTCC
JMFN043H18+ CTCC
rJMFF019P12- GCCAAATGGTATCCATGTTCGCATCCCAACATCCCCATCTCATCCCCGAGCACATACTCC
rJMSF031J24- GCCAAATGGTATCCATGTTCGCATCCCAACATCCCCATCTCATCCCCGAGCACATACTCC
                      ____________________________________________________________
consensus GCCAAATGGTATCCATGTTCGCATCCCAACATCCCCATCTCATCCCCGAGCACATACTCC
 
. : . : . : . : . : . :
rJMSF019I10- TCCTGGCAAATACTGCATTTGTTGTCATCTTCACCCCCTTTCAATCCAGCAACACCTACT
JMFN043H18+ TCCGGGCAAATGGTGAATTTGTTGTCATCTTCACCCCCTTTCAATCCAGCAACACGTACT
rJMFF019P12- TCCTGGCAAATACTGCATTTGTTGTCATCTTCACCCCCTTTCAATCCAGCAACACCTACT
rJMSF031J24- TCCTGGCAAATACTGCATTTGTTGTCATCTTCACCCCCTTTCAATCCAGCAACACCTACT
                      ____________________________________________________________
consensus TCCTGGCAAATACTGCATTTGTTGTCATCTTCACCCCCTTTCAATCCAGCAACACCTACT
 
. : . : . : . : . : . :
rJMSF019I10- CCCGAAGAGGTAACCCGATAGACGCTTCTCCTAAGGCACTTTGACATTGCTTCGTCAGAA
JMFN043H18+ CCCGAAGAGGTAACCCGATAGACGCTTCTCATAAGGCACTTTGACATTGCTTCGTCAGAA
rJMFF019P12- CCCGAAGAGGTAACCCGATAGACGCTTCTCCTAAGGCACTTTGACATTGCTTCGTCAGAA
rJMSF031J24- CCCGAAGAGGTAACCCGATAGACGCTTCTCCTAAGGCACTTTGACATTGCTTCGCCAGAA
                      ____________________________________________________________
consensus CCCGAAGAGGTAACCCGATAGACGCTTCTCCTAAGGCACTTTGACATTGCTTCGTCAGAA
 
. : . : . : . : . : . :
rJMSF019I10- AGAGCTGTGCTTACCGTGCCCATCCTCTCCCCGAGAGCTAGTAATTCCTCGTATGACATG
JMFN043H18+ AGAGCTGTGCTTACCGTGCCCATCCTCTCCCCGAGAGCTAGTAATTCCTCGTAGGACAGG
rJMFF019P12- AGAGCTGTGCTTACCGTGCCCATCCTCTCCCCGAGAGCTAGTAATTCCTCGTATGACATG
rJMSF031J24- AGAGCTGTGCTTACCGTGCCCATCCTCTCCCCGAGAGCTAGTAATTCCTCGTATGACATG
                      ____________________________________________________________
consensus AGAGCTGTGCTTACCGTGCCCATCCTCTCCCCGAGAGCTAGTAATTCCTCGTATGACATG
 
. : . : . : . : . : . :
rJMSF019I10- TTATCGATGTCCAATCTCATGTCTCTATGTTGGTCGTAGAAATTCATGCCATTGAGGAAC
JMFN043H18+ TTATCGATGTCCAATCTCACGTCTCTATGTGGGTCGTAGAAATTCATGCCATTGAGGAAC
rJMFF019P12- TTATCGATGTCCAATCTCATGTCTCTATGTTGGTCGTAGAAATTCATGCCATTGAGGAAC
rJMSF031J24- TTATCGATGTCCAATCTCATGTCTCTATGTTGGTCGTAGAAATTCATGCCATTGAGGAAC
                      ____________________________________________________________
consensus TTATCGATGTCCAATCTCATGTCTCTATGTTGGTCGTAGAAATTCATGCCATTGAGGAAC
 
. : . : . : . : . : . :
rJMSF019I10- ACATTGGTTTCGAGTGCTAGCAGTTGCTCATATCGTAGCTCGTCATCGTGTTCAATTCTC
JMFN043H18+ ACATTGGTTTCGAGTG
rJMFF019P12- ACATTGGTTTCGAGTGCTAGCAGTTGCTCATATCGTAGCTCGTCATCGTGTTCAATTCTC
rJMSF031J24- ACATTGGTTTCGAGTGCTAGCAGTTGCTCATATCGTAGCTCGTCATCGTGTTCAATTCTC
                      ____________________________________________________________
consensus ACATTGGTTTCGAGTGCTAGCAGTTGCTCATATCGTAGCTCGTCATCGTGTTCAATTCTC
 
. : . : . : . : . : . :
rJMSF019I10- TCGAGCTGTAATAATACC
rJMFF019P12- TCGAGCTGTAATAATACC
rJMSF031J24- TCGAGCTGTAATAATACCCCAGCAATTTCATCCATGTTATATCTCCNCANGGCATCACGG
                      ____________________________________________________________
consensus TCGAGCTGTAATAATACCCCAGCAATTTCATCCATGTTATATCTCCNCANGGCATCACGG