Previous Contig 012781:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003G23Sequence621012781 (4)sp|P93111|HMA1_CUCSA4e-84Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.-) (GluTR).>pir|T1018
JMSF016F12Sequence499005614 (2)sp|P93111|HMA1_CUCSA0.003Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.-) (GluTR).>pir|T1018733012781 (4)sp|P93111|HMA1_CUCSA4e-86Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.-) (GluTR).>pir|T1018
JMSF022C06Sequence635006832 (2)sp|P93111|HMA1_CUCSA3e-43Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.-) (GluTR).>pir|T1018794012781 (4)sp|P93111|HMA1_CUCSA1e-95Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.-) (GluTR).>pir|T1018
JMSF031G20Sequence654005614 (2)sp|P93111|HMA1_CUCSA6e-49Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.-) (GluTR).>pir|T1018674012781 (4)sp|P93111|HMA1_CUCSA6e-80Glutamyl-tRNA reductase 1, chloroplast precursor (EC 1.2.1.-) (GluTR).>pir|T1018

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022C06+ AGGAGATGAAAGATGCCG
                      ____________________________________________________________
consensus AGGAGATGAAAGATGCCG
 
. : . : . : . : . : . :
rJMSF022C06+ AGATAATCTATAAGCCCATGTCCGAGATGNTAAACTGTGCTGCAGACTCAGATGTGATCT
                      ____________________________________________________________
consensus AGATAATCTATAAGCCCATGTCCGAGATGNTAAACTGTGCTGCAGACTCAGATGTGATCT
 
. : . : . : . : . : . :
JMFN003G23- ACAAGCACGGCTTCAGAAACCGCCTTGTTTGTAAGAGAGAACGTGATTGGCCTTCCGC
rJMSF022C06+ TTACAAGCACGGCTTCAGAAACCGCCTTGTTTGTAAGAGAGAACGTGATTGGCCTTCCGC
                      ____________________________________________________________
consensus TTACAAGCACGGCTTCAGAAACCGCCTTGTTTGTAAGAGAGAACGTGATTGGCCTTCCGC
 
. : . : . : . : . : . :
JMFN003G23- CTGTAGGCCCTAGCGTCGGGGGGCTAAGGCTTTTCGTGGACATTTCCGTCCCTAGGAATG
rJMSF022C06+ CTGTAGGCCCTAGCGTCGGGGGGCTAAGGCTTTTCGTGGACATTTCCGTCCCTAGGAATG
rJMSF016F12+ GCCCTAGCGTTGGGGGCTTAAGGCTTTTCGTGGATATCTCCGTTCCTAGGAACG
rJMSF031G20+ CCTAGGAACG
                      ____________________________________________________________
consensus CTGTAGGCCCTAGCGTCGGGGGGCTAAGGCTTTTCGTGGACATTTCCGTCCCTAGGAATG
 
. : . : . : . : . : . :
JMFN003G23- TGGGTGCCTGTGTCGACGCTCTCGACACTGCACGAGTGTACAACGTGGACGATCTCAAGG
rJMSF022C06+ TGGGTGCCTGTGTCGACGCTCTCGACACTGCACGAGTGTACAACGTGGACGATCTCAAGG
rJMSF016F12+ TGGGTGCCTGTGTTGATGAGCTCGAGACTTCCCGAGTGTACAACGTGGATGACCTTAAGG
rJMSF031G20+ TGGGTGCCTGTGTTGATGAGCTCGAGACTTCCCGAGTGTACAACGTGGATGACCTTAAGG
                      ____________________________________________________________
consensus TGGGTGCCTGTGTCGACGCTCTCGACACTGCACGAGTGTACAACGTGGACGATCTCAAGG
 
. : . : . : . : . : . :
JMFN003G23- AGGTCGTCGCTGCAAACAAGGAGGACCGCCTTCGCAAAGCAATGGAAGCACAGGCAATTA
rJMSF022C06+ AGGTCGTCGCTGCAAACAAGGAGGACCGCCTTCGCAAAGCAATGGAAGCACAGGCAATTA
rJMSF016F12+ AGGTCGTGGCTGCCAACAAGGAAGACCGGGTTCGAAAAGCAATGGAAGCTCAGGCAATAA
rJMSF031G20+ AGGTCGTGGCTGCCAACAAGGAAGACCGGGTTCGAAAAGCAATGGAAGCTCAGGCGATAA
                      ____________________________________________________________
consensus AGGTCGTCGCTGCAAACAAGGAGGACCGCCTTCGCAAAGCAATGGAAGCACAGGCAATTA
 
. : . : . : . : . : . :
JMFN003G23- TCTCCGAGGAGTCCAGCCAATTCGAAGCCTGGAGGGATTCACTGGAAACCGTCCCGACCA
rJMSF022C06+ TCTCCGAGGAGTCCAGCCAATTCGAAGCCTGGAGGGATTCACTGGAAACCGTCCCGACCA
rJMSF016F12+ TTTCTGAGGAATCAAAACAATTTGAAGCTTGGAGGGATTCACTGGAAACTGTCCCCACCA
rJMSF031G20+ TTTCTGAGGAATCAAAACAATTTGAAGCTTGGAGGGATTCACTGGAAACTGTCCCCACCA
                      ____________________________________________________________
consensus TCTCCGAGGAGTCCAGCCAATTCGAAGCCTGGAGGGATTCACTGGAAACCGTCCCGACCA
 
. : . : . : . : . : . :
JMFN003G23- TCAAGAAACTGAGAGCCTATGCAGAGCGAATACGAGTTGCAGAGCTCGAGAAATGCATGT
rJMSF022C06+ TCAAGAAACTGAGAGCCTATGCAGAGCGAATACGAGTTGCAGAGCTCGAGAAATGCATGT
rJMSF016F12+ TCAAGAAACTGAGGGGTTATGCAGAGAGAATCCGAGCTGCAGAGCTCGAGAAATGCTTGT
rJMSF031G20+ TCAAGAAACTGAGGGGTTATGCAGAGAGAATCCGAGCTGCAGAGCTCGAGAAATGCTTGT
                      ____________________________________________________________
consensus TCAAGAAACTGAGAGCCTATGCAGAGCGAATACGAGTTGCAGAGCTCGAGAAATGCATGT
 
. : . : . : . : . : . :
JMFN003G23- CGAAAATGGGCGATGACATCACAAAGAAGGCGAGGAAAGCGGTGGATGATCTCAGCAGAG
rJMSF022C06+ CGAAAATGGGCGATGACATCACAAAGAAGGCGAGGAAAGCGGTGGATGATCTCAGCAGAG
rJMSF016F12+ CGAAAATGGGGGATGACATCACAAAAAAGACGAGGAAAGCAGTGGATGATCTCAGCAGAG
rJMSF031G20+ CGAAAATGGGGGATGACATCACAAAAAAGACGAGGAAAGCAGTGGATGATCTCAGCAGAG
                      ____________________________________________________________
consensus CGAAAATGGGCGATGACATCACAAAGAAGGCGAGGAAAGCGGTGGATGATCTCAGCAGAG
 
. : . : . : . : . : . :
JMFN003G23- GGATAGTAAACAAGATCCTCCATGGTCCTATGCAGCATTTAAGGTGCGATGGAAGCGATA
rJMSF022C06+ GGATAGTAAACAAGATCCTCCATGGTCCTATGCAGCATTTAAGGTGCGATGGGAGCGATA
rJMSF016F12+ GCATAGTAAACAAGCTTCTTCATGGTCCAATGCAGCATCTGAGGTGTGATGGGAGCGATA
rJMSF031G20+ GCATAGTAAACAAGCTTCTTCATGGTCCAATGCAGCATCTGAGGTGTGATGGGAGCGATA
                      ____________________________________________________________
consensus GGATAGTAAACAAGATCCTCCATGGTCCTATGCAGCATTTAAGGTGCGATGGGAGCGATA
 
. : . : . : . : . : . :
JMFN003G23- GCCGGACTCTAAGCGAAACCCTCGAAAACATGCATGCCCTTAACAGGATGTTCAGCCTGG
rJMSF022C06+ GCCGGACTCTAAGCGAAACCCTCGAAAACATGCATGCCCTTAACAGGATGTTCAGCCTGG
rJMSF016F12+ GCCGCACTTTGAGCGAGACCCTCGAGAACATGCACGCTCTAAACCGGATGTTCAGCCTCG
rJMSF031G20+ GCCGCACTTTGAGCGAGACCCTCGAGAACATGCACGCTCTAAACCGGATGTTCAGCCTCG
                      ____________________________________________________________
consensus GCCGGACTCTAAGCGAAACCCTCGAAAACATGCATGCCCTTAACAGGATGTTCAGCCTGG
 
. : . : . : . : . : . :
JMFN003G23- AAACTGAGATATCAGTGCTGGAACAGAAGATTAGAGCTAAGGTTGAGCAATCACAGAA
rJMSF022C06+ AAACTGAGATATCAGTGCTGGAACAGAAGATTAGAGCTAAGGTTGAGCAATCACAGAA
rJMSF016F12+ AGACTGAAATATCGGTGTTGGAACAGAAGATTAGAGCCAAAGTGGAGCAAACACAGAAGT
rJMSF031G20+ AGACTGAAATATCGGTGTTGGAACAGAAGATTAGAGCCAAAGTGGAGCAAACACAGAAGT
                      ____________________________________________________________
consensus AAACTGAGATATCAGTGCTGGAACAGAAGATTAGAGCTAAGGTTGAGCAATCACAGAAGT
 
. : . : . : . : . : . :
rJMSF016F12+ GACAACCTT
rJMSF031G20+ GACAACCTTAATGGGGGCCAAAAAATGTATGTTTTCTCTGTTGGTTCTGTTGTAAATTCT
                      ____________________________________________________________
consensus GACAACCTTAATGGGGGCCAAAAAATGTATGTTTTCTCTGTTGGTTCTGTTGTAAATTCT
 
. : . : . : . : . : . :
rJMSF031G20+ GGGTGGATATACTTAACAGGACATGATTACTTTGGGGTGATCTATCATTGTTGGTTTGTT
                      ____________________________________________________________
consensus GGGTGGATATACTTAACAGGACATGATTACTTTGGGGTGATCTATCATTGTTGGTTTGTT
 
. : . : . : . : . : . :
rJMSF031G20+ GTTGCTGTTGATTTCTGGCTTTTTCTCAACACATCTGAAAGGAGATTTCCTTCTTTGTAT
                      ____________________________________________________________
consensus GTTGCTGTTGATTTCTGGCTTTTTCTCAACACATCTGAAAGGAGATTTCCTTCTTTGTAT