Previous Contig 012777:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031F18Sequence431012777 (2)674012777 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031F18- GAGCATCTCCGTTCTGCCTCTCCCTCCCGCTCTCAGTCTCAGCCTCGCCGGAATCGG
                      ____________________________________________________________
consensus GAGCATCTCCGTTCTGCCTCTCCCTCCCGCTCTCAGTCTCAGCCTCGCCGGAATCGG
 
. : . : . : . : . : . :
JMSF031F18- AGTCGCTATGCTCGTGTTCTTAGTTCTCAAGCAGTTCTCGCCGCTCGTCTTCTCAGTTCT
                      ____________________________________________________________
consensus AGTCGCTATGCTCGTGTTCTTAGTTCTCAAGCAGTTCTCGCCGCTCGTCTTCTCAGTTCT
 
. : . : . : . : . : . :
JMSF031F18- CAAGCCTCGCTTCGCCGCTCGTCTTCTAAATCTTCTCAGTTCTCACGCAGTGAAGCAAGC
                      ____________________________________________________________
consensus CAAGCCTCGCTTCGCCGCTCGTCTTCTAAATCTTCTCAGTTCTCACGCAGTGAAGCAAGC
 
. : . : . : . : . : . :
JMSF031F18- CTCCCTCGTCTTCTCAGTTCTCAGGCCTCGCCGAAGCCCGGAGTTGCCGGTCGCCGCTCC
                      ____________________________________________________________
consensus CTCCCTCGTCTTCTCAGTTCTCAGGCCTCGCCGAAGCCCGGAGTTGCCGGTCGCCGCTCC
 
. : . : . : . : . : . :
JMSF031F18- TCTTCGCCTGAGTCACGCCCTCACATCTCTGAGTCTCTGAGACACTGCTTGCTCGCGGTT
rJMSF031F18+ GCTTGCTCGCGGTT
                      ____________________________________________________________
consensus TCTTCGCCTGAGTCACGCCCTCACATCTCTGAGTCTCTGAGACACTGCTTGCTCGCGGTT
 
. : . : . : . : . : . :
JMSF031F18- CGCCCTCAACGCCTCAAATCAAAAGCTTTCATTCTTTCAAAGGGAAGTTGCATACATACT
rJMSF031F18+ CGCCCTCAACGCCTCAAATCAAAAGCTTTCATTCTTTCAAAGGGAAGTTGCATACATACT
                      ____________________________________________________________
consensus CGCCCTCAACGCCTCAAATCAAAAGCTTTCATTCTTTCAAAGGGAAGTTGCATACATACT
 
. : . : . : . : . : . :
JMSF031F18- AATTTGATAATTTTTAATTTGTTATTTGAGTAATTGTTTAATTGTTCACTTTGATTTATA
rJMSF031F18+ AATTTGATAATTTTTAATTTGTTATTTGNGTAATTGTTTAATTGTTCACTTTGATTTATA
                      ____________________________________________________________
consensus AATTTGATAATTTTTAATTTGTTATTTGAGTAATTGTTTAATTGTTCACTTTGATTTATA
 
. : . : . : . : . : . :
JMSF031F18- TATTAAAAAAAAAA
rJMSF031F18+ TATTAAAAAAAAAAAATCGCACGAATTTTATTTTTATAAAAAAATGCAGAACTTGCTGCT
                      ____________________________________________________________
consensus TATTAAAAAAAAAAAATCGCACGAATTTTATTTTTATAAAAAAATGCAGAACTTGCTGCT
 
. : . : . : . : . : . :
rJMSF031F18+ TGTTGTGTGTTTCTCCAGAGTCCAGGCTCCAAAATTTCAAGACTCTAAGTATTCATAGTC
                      ____________________________________________________________
consensus TGTTGTGTGTTTCTCCAGAGTCCAGGCTCCAAAATTTCAAGACTCTAAGTATTCATAGTC
 
. : . : . : . : . : . :
rJMSF031F18+ TCCCAGATGGTATGTCTGTGTCAAAGCTCCGATAGGTGAGGAACATAACCGATATGGGAA
                      ____________________________________________________________
consensus TCCCAGATGGTATGTCTGTGTCAAAGCTCCGATAGGTGAGGAACATAACCGATATGGGAA
 
. : . : . : . : . : . :
rJMSF031F18+ TTCACTGATGATTTTTGCTGAAGGAGTGGATTGTTCTCAGCTTTTGGTGAATGTCTTGAC
                      ____________________________________________________________
consensus TTCACTGATGATTTTTGCTGAAGGAGTGGATTGTTCTCAGCTTTTGGTGAATGTCTTGAC
 
. : . : . : . : . : . :
rJMSF031F18+ ACATACTCAAGGAATGACATACATAGCCTAATATTCTTGATTTAGTATAATTGGTTCTCA
                      ____________________________________________________________
consensus ACATACTCAAGGAATGACATACATAGCCTAATATTCTTGATTTAGTATAATTGGTTCTCA
 
. : . : . : . : . : . :
rJMSF031F18+ AACGCCCATCAGGCAGCTCTCCATCCCTTCCTGAATACACTGATGCAGTAAGCATGTGGG
                      ____________________________________________________________
consensus AACGCCCATCAGGCAGCTCTCCATCCCTTCCTGAATACACTGATGCAGTAAGCATGTGGG
 
. : . : . : . : . : . :
rJMSF031F18+ TGAGTTAGATAGTTTCCCTCTGCCATTGAATTTGATGCTATTGATGGCAGGAGAGCTGAT
                      ____________________________________________________________
consensus TGAGTTAGATAGTTTCCCTCTGCCATTGAATTTGATGCTATTGATGGCAGGAGAGCTGAT
 
. : . : . : . : . : . :
rJMSF031F18+ CATCATCACCTCCATCCCAACCTAATTGATCTTAATGTGGATTGTAATTTGTGAAAACTA
                      ____________________________________________________________
consensus CATCATCACCTCCATCCCAACCTAATTGATCTTAATGTGGATTGTAATTTGTGAAAACTA
 
. : . : . : . : . : . :
rJMSF031F18+ TTATATTGTTGTGGATTGATAATGTATTATTACTTTAACTTAANCGTTGATTGATAATGT
                      ____________________________________________________________
consensus TTATATTGTTGTGGATTGATAATGTATTATTACTTTAACTTAANCGTTGATTGATAATGT