Previous Contig 012773:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021G12Sequence697005980 (4)gb:AC002535_15308419e-36Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>777012773 (3)gb:AC104272_17373523e-73Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMSF021I05Sequence671005980 (4)gb:AC002535_15308413e-55Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>772012773 (3)gb:AC104272_17373522e-75Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMSF031E13Sequence694005980 (4)gb:AC002535_15308412e-40Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>768012773 (3)gb:AC104272_17373522e-54Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021G12+ TGGTGCCAACATGCTTGCTGCTGCTGGNGCTGGGGCTGCAACAACAATG
rJMSF021I05+ ACAATT
                      ____________________________________________________________
consensus TGGTGCCAACATGCTTGCTGCTGCTGGNGCTGGGGCTGCAACAACAATT
 
. : . : . : . : . : . :
rJMSF021G12+ GCCACAAATCCTCTNTGGGTTGTGAAGACTAGACTTCAGACTCAAGGAATGAGAGCTGGT
rJMSF021I05+ GCCACAAATTCTCTTTGGGTTGTGANGACTAGACTTCAGACTCAAGGAATGAGAGCTGGT
                      ____________________________________________________________
consensus GCCACAAATTCTCTTTGGGTTGTGAAGACTAGACTTCAGACTCAAGGAATGAGAGCTGGT
 
. : . : . : . : . : . :
rJMSF021G12+ TTTGTGCCATATAGGGGTACATTATCGGCTCTAAGAAGAATAGCTCGTGAAGAGGGCATT
rJMSF021I05+ TTTGTGCCATATAGGGGTACATTATCGGCTCTAAGAAGAATAGCTCGTGAAGAGGGCATT
                      ____________________________________________________________
consensus TTTGTGCCATATAGGGGTACATTATCGGCTCTAAGAAGAATAGCTCGTGAAGAGGGCATT
 
. : . : . : . : . : . :
rJMSF021G12+ CGTGGGCTGTATAGTGGTCTTGTGCCTGCTCTGGCGGGTGTTAGTCATGNTGCTATCCAG
rJMSF021I05+ CGTGGGCTGTATAGTGGTCTTGTGCCTGCTCTGGCGGGTGTTAGTCATGTTGCTATCCAG
rJMSF031E13+ AGTGGTCTTGTGCCTGCTCTGGCGGGTGTTAGTCATGTTGCTATCCAG
                      ____________________________________________________________
consensus CGTGGGCTGTATAGTGGTCTTGTGCCTGCTCTGGCGGGTGTTAGTCATGTTGCTATCCAG
 
. : . : . : . : . : . :
rJMSF021G12+ TTTCCAACATATGAGAAGATCAAGATATATTTGGNTAATCGGGATAACACTAGTATGGAC
rJMSF021I05+ TTTCCAACATATGAGAAGATCAAGATATATTTGGCTAATCGGGATAACACTAGTATGGAC
rJMSF031E13+ TTTCCAACATATGAGAAGATCAAGATATATTTGGCTAATCGGGATAACACTAGTATGGAC
                      ____________________________________________________________
consensus TTTCCAACATATGAGAAGATCAAGATATATTTGGCTAATCGGGATAACACTAGTATGGAC
 
. : . : . : . : . : . :
rJMSF021G12+ AAACTCAGTGCCAGCAATGTCGCTGTTGCATCATCAGTTTCAAAAATATTTGCTTCTACA
rJMSF021I05+ AAACTCAGTGCCAGCAATGTCGCTGTTGCATCATCAGTTTCAAAAATATTTGCTTCTACA
rJMSF031E13+ AAACTCAGTGCCAGCAATGTCGCTGTTGCATCATCAGTTTCAAAAATATTTGCTTCTACA
                      ____________________________________________________________
consensus AAACTCAGTGCCAGCAATGTCGCTGTTGCATCATCAGTTTCAAAAATATTTGCTTCTACA
 
. : . : . : . : . : . :
rJMSF021G12+ ATGACATATCCACATGAGGTTGTGCGGTCAAGGCTTCAAGAACAGGGCCTACACTCGGAG
rJMSF021I05+ ATGACATATCCACATGAGGTTGTGCGGTCAAGGCTTCAAGAACAGGGCCTACACTCGGAG
rJMSF031E13+ ATGACATATCCACATGAGGTTGTGCGGTCAAGGCTTCAAGAACAGGGCCTACACTCGGAG
                      ____________________________________________________________
consensus ATGACATATCCACATGAGGTTGTGCGGTCAAGGCTTCAAGAACAGGGCCTACACTCGGAG
 
. : . : . : . : . : . :
rJMSF021G12+ AAACGCTATAGTGGTGTGATTGACTGCGTTAGGAAAGTTTTCCAGCAAGAAGGCATCCCT
rJMSF021I05+ AAACGCTATAGTGGTGTGATTGACTGCGTTAGGAAAGTTTTCCAGCAAGAAGGCATCCCT
rJMSF031E13+ AAACGCTATAGTGGTGTGATTGACTGCGTTAGGAAAGTTTTCCAGCAAGAAGGCATCCCT
                      ____________________________________________________________
consensus AAACGCTATAGTGGTGTGATTGACTGCGTTAGGAAAGTTTTCCAGCAAGAAGGCATCCCT
 
. : . : . : . : . : . :
rJMSF021G12+ GGTTTTTATCGAGGTTGTGCTACCAATTTAATCCGGACCACACCAGCAGCTGTAATTACC
rJMSF021I05+ GGTTTTTATCGAGGTTGTGCTACCAATTTAATCCGGACCACACCAGCAGCTGTAATTACC
rJMSF031E13+ GGTTTTTATCGAGGTTGTGCTACCAATTTAATCCGGACCACACCAGCAGCTGTAATTACC
                      ____________________________________________________________
consensus GGTTTTTATCGAGGTTGTGCTACCAATTTAATCCGGACCACACCAGCAGCTGTAATTACC
 
. : . : . : . : . : . :
rJMSF021G12+ TTCACCAGTTTTGAGATGATACACCGTTTTCTAGTTTCAGTGTTCCCCCCTGATCCTCAG
rJMSF021I05+ TTCACCAGTTTTGAGATGATACACCGTTTTCTAGTTTCAGTGTTCCCCCCTGATCCTCAG
rJMSF031E13+ TTCACCAGTTTTGAGATGATACACCGTTTTCTAGTTTCAGTGTTCCCCCCTGATCCTCAG
                      ____________________________________________________________
consensus TTCACCAGTTTTGAGATGATACACCGTTTTCTAGTTTCAGTGTTCCCCCCTGATCCTCAG
 
. : . : . : . : . : . :
rJMSF021G12+ CCACAACCACTGTGAGGATCAATATCATCGNGCATTGGAAATTATTATGGANTGAGTTAG
rJMSF021I05+ CCACAACCACTGTGAGGATCAATATCATCGTGCATTGGAAATTATTATGGATTGAGTTAG
rJMSF031E13+ CCACAACCACTGTGAGGATCAATATCATCGTGCATTGGAAATTATTATGGATTGAGTTAG
                      ____________________________________________________________
consensus CCACAACCACTGTGAGGATCAATATCATCGTGCATTGGAAATTATTATGGATTGAGTTAG
 
. : . : . : . : . : . :
rJMSF021G12+ TNGGCTAGAACAGAATGTGGCCTTCCGCATAGGTTGTCANGGGTAAATTATAGAATCGCA
rJMSF021I05+ TTGGCTAGAACAGAATGTGGCCTTCCGCATAGGTTGTCATGGGTAAATTATAGAATCGCA
rJMSF031E13+ TTGGCTAGAACAGAATGTGGCCTTCCGCATAGGTTGTCATGGGTAAATTATAGAATCGCA
                      ____________________________________________________________
consensus TTGGCTAGAACAGAATGTGGCCTTCCGCATAGGTTGTCATGGGTAAATTATAGAATCGCA
 
. : . : . : . : . : . :
rJMSF021G12+ AGATTGCAATTGCGTTAGGACACTGTAACAAACCGCCGCCTATACTGAAATGATAATGAT
rJMSF021I05+ AGATTGCAATTGCGTTAGGACACTGTAACAAACCGCCGCCTATACTGAAATGATAATGAT
rJMSF031E13+ AGATTGCAATTGCGTTAGGACACTGTAACAAACCGCCGCCTATACTGAAATGATAATGAT
                      ____________________________________________________________
consensus AGATTGCAATTGCGTTAGGACACTGTAACAAACCGCCGCCTATACTGAAATGATAATGAT
 
. : . : . : . : . : . :
rJMSF021G12+ GAAAAAAG
rJMSF021I05+ GAAAAAAGTGTTTAAGATGCTATAGACAAATTAAACTACATTTTG
rJMSF031E13+ GAAAAAAGTGTTTAAGATGCTATAGACAAATTAAACTACATTTTGGTTTTGAAGAATGTG
                      ____________________________________________________________
consensus GAAAAAAGTGTTTAAGATGCTATAGACAAATTAAACTACATTTTGGTTTTGAAGAATGTG