Previous Contig 012771:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033P18Sequence300005540 (3)gb:AF204785_17766571e-07Lycopersicon esculentum ripening regulated protein DDTFR18 (DDTFR18) mRNA, compl727012771 (3)gb:AB011479_15114412e-84Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.>gb:AY143960_15834
JMSF015F17Sequence420005540 (3)gb:AB011479_15114411e-28Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.>gb:AY143960_15834737012771 (3)gb:AB011479_15114412e-88Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.>gb:AY143960_15834
JMSF031D19Sequence665005540 (3)gb:AF204785_17766571e-64Lycopersicon esculentum ripening regulated protein DDTFR18 (DDTFR18) mRNA, compl769012771 (3)gb:AB011479_15114411e-83Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.>gb:AY143960_15834

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033P18+ GGAGTCAT
rJMSF015F17+ CATCCGGAGTCAT
                      ____________________________________________________________
consensus CATCCGGAGTCAT
 
. : . : . : . : . : . :
rJMFF033P18+ GCTATGCTTGGAAAATTGGTACTACAGAATTTTGATAGTGATGACAGGAAATTTAGAGAA
rJMSF015F17+ GCTATGCTTGGAAAATTGGTACTACAGAATTTTGATAGTGATGACAGGAAATTTAGAGAA
rJMSF031D19+ AAAATTGGTACTACAGAATTTTGATAGTGATGACAGGAAATTTAGAGAA
                      ____________________________________________________________
consensus GCTATGCTTGGAAAATTGGTACTACAGAATTTTGATAGTGATGACAGGAAATTTAGAGAA
 
. : . : . : . : . : . :
rJMFF033P18+ TGCTAAAATTGCCGTTGATGCGTTGTCAATATGTATGAACATTAACGGCTGGGAACTGAT
rJMSF015F17+ TGCTAAAATTGCCGTTGATGCGTTGTCAATATGTATGAACATTAACGGCTGGGAACTGAT
rJMSF031D19+ TGCTAAAATTGCCGTTGATGCGTTGTCAATATGTATGAACATTAACGGCTGGGAACTGAT
                      ____________________________________________________________
consensus TGCTAAAATTGCCGTTGATGCGTTGTCAATATGTATGAACATTAACGGCTGGGAACTGAT
 
. : . : . : . : . : . :
rJMFF033P18+ GATTCCTCTTGTTTTCTTCGCTGGAANTGGTGTTAGGGTAGCAAATGAGTTAGGAGCAGG
rJMSF015F17+ GATTCCTCTTGGTTTCTTCGCTGGAACTGGTGTTAGGGTAGCAAATGAGTTAGGAGCAGG
rJMSF031D19+ GATTCCTCTTGGTTTCTTCGCTGGAACTGGTGTTAGGGTAGCAAATGAGTTAGGAGCAGG
                      ____________________________________________________________
consensus GATTCCTCTTGGTTTCTTCGCTGGAACTGGTGTTAGGGTAGCAAATGAGTTAGGAGCAGG
 
. : . : . : . : . : . :
rJMFF033P18+ GAATGGAAAAGGAGCAAAGTTCGCGGCATTTGTATCAGTGTCACACTCCATGATAATTGG
rJMSF015F17+ GAATGGAAAAGGGGCAAAGTTCGCGGCATTTGTATCAGTGTCACACTCCATGATAATTGG
rJMSF031D19+ GAATGGAAAAGGAGCAAAGTTCGCGGCATTTGTATCAGTGTCACACTCCATGATAATTGG
                      ____________________________________________________________
consensus GAATGGAAAAGGAGCAAAGTTCGCGGCATTTGTATCAGTGTCACACTCCATGATAATTGG
 
. : . : . : . : . : . :
rJMFF033P18+ TCTNTTNTTTTGGCTGCTAATCNTAACNTTCGACAACCAGCTTGCCNTAATTTTCTCCTN
rJMSF015F17+ TCTCTTCTTTTGGCTGCTAATCCTAACCTTCGACAACCAGCTTGCCCTAATTTTCTCCTC
rJMSF031D19+ TCTCTTCTTTTGGCTGCTAATCCTAACCTTCGACAACCAGCTTGCCCTAATTTTCTCCTC
                      ____________________________________________________________
consensus TCTCTTCTTTTGGCTGCTAATCCTAACCTTCGACAACCAGCTTGCCCTAATTTTCTCCTC
 
. : . : . : . : . : . :
rJMFF033P18+ TAGTCAAATTGTTCTTGACGCCGTTCATGACCTCTCATTCCTNTTAGCATTCACCGTTCT
rJMSF015F17+ TAGTCAAATTGTTCTTGACGCCGTTCATGACCTCTCATTCCTCTTAGCATTCACCGTTCT
rJMSF031D19+ TAGTCAAATTGTTCTTGACGCCGTTCATGACCTCTCATTCCTCTTAGCATTCACCGTTCT
                      ____________________________________________________________
consensus TAGTCAAATTGTTCTTGACGCCGTTCATGACCTCTCATTCCTCTTAGCATTCACCGTTCT
 
. : . : . : . : . : . :
rJMFF033P18+ TCTCAACAGCATTCAACCAATCCTATCAGGGGTGGCTGTTGGATCTGGGTGGCAAGCATA
rJMSF015F17+ TCTCAACAGCATTCAACCAATCCTATCAGGGGTGGCTGTTGGATCTGGGTGGCAAGCATA
rJMSF031D19+ TCTCAACAGCATTCAACCAATCCTATCAGGGGTGGCTGTTGGATCTGGGTGGCAAGCATA
                      ____________________________________________________________
consensus TCTCAACAGCATTCAACCAATCCTATCAGGGGTGGCTGTTGGATCTGGGTGGCAAGCATA
 
. : . : . : . : . : . :
rJMFF033P18+ TGTAGCATACATAAACCTTGGGTGCTACTATTTGGTTGGAGTCCCTCTTGGCATTATGAT
rJMSF015F17+ TGTAGCATACATAAACCTTGGGTGCTACTATTTGGTTGGAGTCCCTCTTGGCATTATGAT
rJMSF031D19+ TGTAGCATACATAAACCTTGGGTGCTACTATTTGGTTGGAGTCCCTCTTGGCATTATGAT
                      ____________________________________________________________
consensus TGTAGCATACATAAACCTTGGGTGCTACTATTTGGTTGGAGTCCCTCTTGGCATTATGAT
 
. : . : . : . : . : . :
rJMFF033P18+ GGAATGGGTTTTCCACCAAGGTGTCAAGGGGATATGGGCTGGGATGATCTTTGGTGGAAC
rJMSF015F17+ GGAATGGGTTTTCCACCAAGGTGTCAAGGGGATATGGGCTGGGATGATCTTTGGTGGAAC
rJMSF031D19+ GGAATGGGTTTTCCACCAAGGTGTCAAGGGGATATGGGCTGGGATGATCTTTGGTGGAAC
                      ____________________________________________________________
consensus GGAATGGGTTTTCCACCAAGGTGTCAAGGGGATATGGGCTGGGATGATCTTTGGTGGAAC
 
. : . : . : . : . : . :
rJMFF033P18+ AGCAATGCAACCTATAATTTTGTGTATAATCNCCATAAGATGTGATTGGGAAAAAGAGGC
rJMSF015F17+ AGCAATGCAAACTATAATTTTGTGTATAATCACCATAAGATGTGATTGGGAAAAAGAGGC
rJMSF031D19+ AGCAATGCAAACTATAATTTTGTGTATAATCACCATAAGATGTGATTGGGAAAAAGAGGC
                      ____________________________________________________________
consensus AGCAATGCAAACTATAATTTTGTGTATAATCACCATAAGATGTGATTGGGAAAAAGAGGC
 
. : . : . : . : . : . :
rJMFF033P18+ TCAGAAGGCGAATACGCACATTAAGAAGTGGGAAAGCGTGAGTCACGGTGCCTCGTAGAA
rJMSF015F17+ TCAGAAGGCGAATACGCACATTAAGAAGTGGGAAAGCGTGAGTCACGGTGCCTCGTAGAA
rJMSF031D19+ TCAGAAGGCGAATACGCACATTAAGAAGTGGGAAAGCGTGAGTCACGGTGCCTCGTAGAA
                      ____________________________________________________________
consensus TCAGAAGGCGAATACGCACATTAAGAAGTGGGAAAGCGTGAGTCACGGTGCCTCGTAGAA
 
. : . : . : . : . : . :
rJMFF033P18+ GTTTAGAATTTTCATTTGTTAATATAATATAATATATGATGGCGAAGATTTACTAATTT
rJMSF015F17+ GTTTAGAATTTTCATTTGTTAATATAATATAATATATGATGGCGAAGATTTACTAATTT
rJMSF031D19+ GTTTAGAATTTTCATTTGTTAATATAATATAATATATGATGGCGAAGATTTACTAATTTT
                      ____________________________________________________________
consensus GTTTAGAATTTTCATTTGTTAATATAATATAATATATGATGGCGAAGATTTACTAATTTT
 
. : . : . : . : . : . :
rJMSF031D19+ GAGGAATTGATCTTTCATTTAATGGATTTTAATTTTCTATTAATTATAATGAGGGAATCA
                      ____________________________________________________________
consensus GAGGAATTGATCTTTCATTTAATGGATTTTAATTTTCTATTAATTATAATGAGGGAATCA