Previous Contig 012768:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031D04Sequence611005328 (5)gb:AF250342_17808764e-74Arabidopsis thaliana SMC-related protein MSS2 (MSS2) mRNA, partial cds.732012768 (2)gb:AC144455_17441079e-70Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0086G17, complet
JMSF032H09Sequence674005328 (5)gb:AF250342_17808763e-83Arabidopsis thaliana SMC-related protein MSS2 (MSS2) mRNA, partial cds.687012768 (2)gb:AC144455_17441073e-75Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0086G17, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031D04+ AGGAAGTTGGCNT
                      ____________________________________________________________
consensus AGGAAGTTGGCNT
 
. : . : . : . : . : . :
rJMSF032H09+ TGAGAGACCTTGTCTCTCAGATAAATGACACTTTCAGTCGTAATTTTAGAGAAA
rJMSF031D04+ CCAACATGAGAGACCTTGTCTCTCAGATAAATGACACTTTCAGTCGTAATTTTAGAGAAA
                      ____________________________________________________________
consensus CCAACATGAGAGACCTTGTCTCTCAGATAAATGACACTTTCAGTCGTAATTTTAGAGAAA
 
. : . : . : . : . : . :
rJMSF032H09+ TGGCTGTTGCAGGAGAGGTTTCATTGGATGAGCACGATATGGACTTTGATAAATATGGGA
rJMSF031D04+ TGGCTG-TGCAGGAGAGGTTTCATTGGATGAGCACGATATGGACTTTGATAAATATGGGA
                      ____________________________________________________________
consensus TGGCTGTTGCAGGAGAGGTTTCATTGGATGAGCACGATATGGACTTTGATAAATATGGGA
 
. : . : . : . : . : . :
rJMSF032H09+ TTCTAATTAGAGTTCAATTCAGGGAAACAGGACAACTTCAAATTCTTAGTGCCCACCACC
rJMSF031D04+ TTCTAATTAGAGTTCAATTCAGGGAAACAGGACAACTTCAAATTCTTAGTGCCCACCACC
                      ____________________________________________________________
consensus TTCTAATTAGAGTTCAATTCAGGGAAACAGGACAACTTCAAATTCTTAGTGCCCACCACC
 
. : . : . : . : . : . :
rJMSF032H09+ AATCTGGAGGCGAGCGCTCTGTTTCAACTATTCTTTACCTTGTTTCTCTTCAAGACCTAA
rJMSF031D04+ AATCTGGAGGCGAGCGCTCTGTTTCAACTATTCTTTACCTTGTTTCTCTTCAAGACCTAA
                      ____________________________________________________________
consensus AATCTGGAGGCGAGCGCTCTGTTTCAACTATTCTTTACCTTGTTTCTCTTCAAGACCTAA
 
. : . : . : . : . : . :
rJMSF032H09+ CCACTTGCCCTTTTAGAGTGGTTGATGAAATAAATCAAGGAATGGATCCAGTTAATGAAA
rJMSF031D04+ CCACTTGCCCTTTTAGAGTGGTTGATGAAATAAATCAAGGAATGGATCCAGTTAATGAAA
                      ____________________________________________________________
consensus CCACTTGCCCTTTTAGAGTGGTTGATGAAATAAATCAAGGAATGGATCCAGTTAATGAAA
 
. : . : . : . : . : . :
rJMSF032H09+ GGAAAATGTTTCAGCAATTAGTCAGAGCAGCCAGCCAACGTAATACACCACAGTGTTTCC
rJMSF031D04+ GGAAAATGTTTCAGCAATTAGTCAGAGCAGCCAGCCAACGTAATACACCACAGTGTTTCC
                      ____________________________________________________________
consensus GGAAAATGTTTCAGCAATTAGTCAGAGCAGCCAGCCAACGTAATACACCACAGTGTTTCC
 
. : . : . : . : . : . :
rJMSF032H09+ TACTTACCCCAAAACTCTTGCCGAATCTTGACTATAGCGATGCATGCAGTGTTCTCACTG
rJMSF031D04+ TACTTACCCCAAAACTCTTGCCGAATCTTGACTATAGCGATGCATGCAGTGTTCTCACTG
                      ____________________________________________________________
consensus TACTTACCCCAAAACTCTTGCCGAATCTTGACTATAGCGATGCATGCAGTGTTCTCACTG
 
. : . : . : . : . : . :
rJMSF032H09+ TAATGAACGGGCCATGGATTGAGCAGGCTTCCAAAGCCTGGATCAATGGAGAAAGCTGGA
rJMSF031D04+ TAATGAACGGGCCATGGATTGAGCAGGCTTCCAAAGCCTGGATCAATGGAGAAAGCTGGA
                      ____________________________________________________________
consensus TAATGAACGGGCCATGGATTGAGCAGGCTTCCAAAGCCTGGATCAATGGAGAAAGCTGGA
 
. : . : . : . : . : . :
rJMSF032H09+ GATCAGTGACGAGGAGGGCATCAGAAGAGAGGTGTCACTAGGAAATGTAAATCATGCATG
rJMSF031D04+ GATCAGTGACGAGGAGGGCATCAGAAGAGAGGTGTCACTAGGAAATGTAAATCATGCATG
                      ____________________________________________________________
consensus GATCAGTGACGAGGAGGGCATCAGAAGAGAGGTGTCACTAGGAAATGTAAATCATGCATG
 
. : . : . : . : . : . :
rJMSF032H09+ GAGATTGCACCATATGCTTGCTGTTTTTGAGAGCTCCAGTAGTAGCTGATTACTTGAATC
rJMSF031D04+ GAGATTGCACCATATGCTTGCTGTTTTTGAGAGCTCCAGTAGTAGCTGATTACTTGAATC
                      ____________________________________________________________
consensus GAGATTGCACCATATGCTTGCTGTTTTTGAGAGCTCCAGTAGTAGCTGATTACTTGAATC
 
. : . : . : . : . : . :
rJMSF032H09+ TGTTGTATATGTGTGTTTTGCTGATAACCTGAATCTAGAAATCATTCTGCCCTTCAACAT
rJMSF031D04+ TGTTGTATATGTGTGTTTTGCTGATAACCTGAATCTAGAAATCATTCTGCCCTTCAACAT
                      ____________________________________________________________
consensus TGTTGTATATGTGTGTTTTGCTGATAACCTGAATCTAGAAATCATTCTGCCCTTCAACAT
 
. : . : . : . : . : . :
rJMSF032H09+ TTCTGAAGTTTCAAACATCAAGTTCTAGTAGT
rJMSF031D04+ TTCTGAAGTTTCAAACATCAAGTTCTTGTAGTAAGCTGTAATAGGCTGTATATTGATATC
                      ____________________________________________________________
consensus TTCTGAAGTTTCAAACATCAAGTTCTTGTAGTAAGCTGTAATAGGCTGTATATTGATATC