Previous Contig 012764:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001D23Sequence383006761 (10)pir|A84857|A848572e-31probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi750012764 (2)pir|A84857|A848575e-70probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi
JMSF031B22Sequence641006761 (10)pir|A84857|A848572e-67probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi681012764 (2)pir|A84857|A848571e-60probable lipase [imported] - Arabidopsis thaliana>gb:AC006931_1534840 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001D23+ AAACTCGCGCTTCACTACCCTAAGTGCAAGGGAACAACTCCAAACAAAGATTG
                      ____________________________________________________________
consensus AAACTCGCGCTTCACTACCCTAAGTGCAAGGGAACAACTCCAAACAAAGATTG
 
. : . : . : . : . : . :
rJMSF001D23+ AAGAGTTGAGGAGCAAATACAAAGGAGAGAATTTGAGCATCATAGTCACGGGGCATAGTC
rJMSF031B22+ CGGGGCATAGTC
                      ____________________________________________________________
consensus AAGAGTTGAGGAGCAAATACAAAGGAGAGAATTTGAGCATCATAGTCACGGGGCATAGTC
 
. : . : . : . : . : . :
rJMSF001D23+ TCGGTGCAACTTTAGCAACCCTAGCAAGTTTTGATCTATGCGAAAACGGCGTCACCGACA
rJMSF031B22+ TCGGTGCAACTTTAGCAACCCTAGCAAGTTTTGATCTATGCGAAAACGGCGTCACCGACA
                      ____________________________________________________________
consensus TCGGTGCAACTTTAGCAACCCTAGCAAGTTTTGATCTATGCGAAAACGGCGTCACCGACA
 
. : . : . : . : . : . :
rJMSF001D23+ TTCCGGTGACGGCCATAGTCTTCGGCAGCCCTCAAATAGGCAACCAAGTGTTCGATAAAA
rJMSF031B22+ TTCCGGTGACGGCCATAGTCTTCGGCAGCCCTCAAATAGGCAACCAAGTGTTCGATAAAA
                      ____________________________________________________________
consensus TTCCGGTGACGGCCATAGTCTTCGGCAGCCCTCAAATAGGCAACCAAGTGTTCGATAAAA
 
. : . : . : . : . : . :
rJMSF001D23+ TGATGGGTGAAAAGACGAACCTTAAAATCTTACACATCCGCAACAAGATTGATATGATTC
rJMSF031B22+ TGATGGGTGAAAAGACGAACCTTAAAATCTTACACATCCGCAACAAGATTGATATGATTC
                      ____________________________________________________________
consensus TGATGGGTGAAAAGACGAACCTTAAAATCTTACACATCCGCAACAAGATTGATATGATTC
 
. : . : . : . : . : . :
rJMSF001D23+ CTGAGTACCCAGGAGCTCTATTAGGGTACGTGAAGTCGGGACTAGAGTTCGTGATCGACC
rJMSF031B22+ CTGAGTACCCAGGAGCTCTATTAGGGTACGTGAAGTCGGGACTAGAGTTCGTGATCGACC
                      ____________________________________________________________
consensus CTGAGTACCCAGGAGCTCTATTAGGGTACGTGAAGTCGGGACTAGAGTTCGTGATCGACC
 
. : . : . : . : . : . :
rJMSF001D23+ ACCGAAAGTCGACGATCCTGAAGAAGTCAATGAACACGGGAGACTGGCACAACTTGCAGG
rJMSF031B22+ ACCGAAAGTCGACGATCCTGAAGAAGTCAATGAACACGGGAGACTGGCACAACTTGCAGG
                      ____________________________________________________________
consensus ACCGAAAGTCGACGATCCTGAAGAAGTCAATGAACACGGGAGACTGGCACAACTTGCAGG
 
. : . : . : . : . : . :
rJMSF001D23+ CCATGTTGCACGTTGTGGCTGGGTGGAATGGGGAAGATAGGGAGTTTGAGTTGAAGGTGA
rJMSF031B22+ CCATGTTGCACGTTGTGGCTGGGTGGAATGGGGAAGATAGGGAGTTTGAGTTGAAGGTGA
                      ____________________________________________________________
consensus CCATGTTGCACGTTGTGGCTGGGTGGAATGGGGAAGATAGGGAGTTTGAGTTGAAGGTGA
 
. : . : . : . : . : . :
rJMSF001D23+ AGAGGTGTGTGGCCCTTGTGAACAAGTCTTGTGAGTTCTTGAGGGAAGAGCTTTTGATTC
rJMSF031B22+ AGAGGTGTGTGGCCCTTGTGAACAAGTCTTGTGAGTTCTTGAGGGAAGAGCTTTTGATTC
                      ____________________________________________________________
consensus AGAGGTGTGTGGCCCTTGTGAACAAGTCTTGTGAGTTCTTGAGGGAAGAGCTTTTGATTC
 
. : . : . : . : . : . :
rJMSF001D23+ CGGGCTCATGGTGGGTTGAGAAGAATAAAAGTATGGTTCTTGATGAAAATGGAGAGTCGG
rJMSF031B22+ CGGGCTCATGGTGGGTTGAGAAGAATAAAAGTATGGTTCTTGATGAAAATGGAGAGTCGG
                      ____________________________________________________________
consensus CGGGCTCATGGTGGGTTGAGAAGAATAAAAGTATGGTTCTTGATGAAAATGGAGAGTCGG
 
. : . : . : . : . : . :
rJMSF001D23+ TTTTGGCATCACCTAATGACGAAGACCTACCCGTCCCTGAATACTAA
rJMSF031B22+ TTTTGGCATCACCTAATGACGAAGACCTACCCGTCCCTGAATACTAAATATGTATTAGCT
                      ____________________________________________________________
consensus TTTTGGCATCACCTAATGACGAAGACCTACCCGTCCCTGAATACTAAATATGTATTAGCT
 
. : . : . : . : . : . :
rJMSF031B22+ ATTGTCATTTAGGCCACGCAACTTTAACGGGTAAAGGATTAGCCAAGAAGTTAAGACAAC
                      ____________________________________________________________
consensus ATTGTCATTTAGGCCACGCAACTTTAACGGGTAAAGGATTAGCCAAGAAGTTAAGACAAC
 
. : . : . : . : . : . :
rJMSF031B22+ TTCTTATAATTAAGAGTCTTGTGATTATTAAGTTAATTGTTAGAACAATTTAGCCTGTGT
                      ____________________________________________________________
consensus TTCTTATAATTAAGAGTCTTGTGATTATTAAGTTAATTGTTAGAACAATTTAGCCTGTGT