Previous Contig 012763:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003M08Sequence245006712 (4)gb:AB012245_15117661e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638746012763 (4)gb:AP002899_18236863e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF031B14Sequence669006712 (4)gb:AB012245_15117661e-44Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638736012763 (4)gb:AP002899_18236862e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF032M22Sequence588006712 (4)gb:AB012245_15117664e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638672012763 (4)gb:AP002899_18236868e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF043C11Sequence750006712 (4)gb:AB012245_15117663e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638689012763 (4)gb:AP002899_18236861e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043C11+ CT
                      ____________________________________________________________
consensus CT
 
. : . : . : . : . : . :
rJMSF043C11+ GCTGTCGTTGCGCTTCTTAAAGCCATACATCCTGACTGGAGTGGTGCTGCCATAAAATCT
rJMSF032M22+ CTTAAAGCCATACATCCTGACTGGAGTGGTGCTGCCATAAAATCT
rJMSF003M08+ TGTCGTTGCGCTTCTTAAAGCCATACATCCTGACTGGAGTGGTGCTGCCATAAAATCT
rJMSF031B14+ GTGCTGCCATAAAATCT
                      ____________________________________________________________
consensus GCTGTCGTTGCGCTTCTTAAAGCCATACATCCTGACTGGAGTGGTGCTGCCATAAAATCT
 
. : . : . : . : . : . :
rJMSF043C11+ GCTATTATGACAACTGCTACAACTAAGAATGTGAAAGGAGAAGCAATAAAGGATGCATAT
rJMSF032M22+ GCTATTATGACAACTGCTACAACTAAGAATGTGAAAGGAGAAGCAATAAAGGATGCATAT
rJMSF003M08+ GCTATTATGACAACTGCTACAACTAAGAATGTGAAAGGAGAAGCAATAAAGGATGCATAT
rJMSF031B14+ GCTATTATGACAACTGCTACAACTAAGAATGTGAAAGGAGAAGCAATAAAGGATGCATAT
                      ____________________________________________________________
consensus GCTATTATGACAACTGCTACAACTAAGAATGTGAAAGGAGAAGCAATAAAGGATGCATAT
 
. : . : . : . : . : . :
rJMSF043C11+ GGAGAAGTTGCAGGTCCTTTCCATTACGGGGCAGGCCATATTCAGCCATCAAAAGCGGCT
rJMSF032M22+ GGAGAAGTTGCAGGTCCTTTCCATTACGGGGCAGGCCATATTCAGCCATCAAAAGCGGCT
rJMSF003M08+ GGAGAAGTTGCAGGTCCTTTCCATTACGGGGCAGGCCATATTCAGCCATCAAAAGCGGCT
rJMSF031B14+ GGAGAAGTTGCAGGTCCTTTCCATTACGGGGCAGGCCATATTCAGCCATCAAAAGCGGCT
                      ____________________________________________________________
consensus GGAGAAGTTGCAGGTCCTTTCCATTACGGGGCAGGCCATATTCAGCCATCAAAAGCGGCT
 
. : . : . : . : . : . :
rJMSF043C11+ GATCCCGGGCTTGTATACGATTCAACATACATGGACTATCTTCTCTTTGTTTGCTCCAGT
rJMSF032M22+ GATCCCGGGCTTGTATACGATTCAACATACATGGACTATCTTCTCTTTGTTTGCTCCAGT
rJMSF003M08+ GATCCCGGGCTTGTATACGATTCAACATACATGGACTATCTTCTCTTTGTTTGCTCCAGT
rJMSF031B14+ GATCCCGGGCTNGTATACGATTCAACATACATGGACTATCTTCTCTTTGTTTGCTCCAGT
                      ____________________________________________________________
consensus GATCCCGGGCTTGTATACGATTCAACATACATGGACTATCTTCTCTTTGTTTGCTCCAGT
 
. : . : . : . : . : . :
rJMSF043C11+ ATCGGCACTACACTAGACCCCTCTTACAAATGCCCAAAGAAAGCTTCATCTCCAAGTAAT
rJMSF032M22+ ATCGGCACTACACTAGACCCCTCTTACAAATGCCCAAAGAAAGCTTCATCTCCAAGTAAT
rJMSF003M08+ ATCGGCACTACACTAGACCCCTCTTACAAATGCCCAAAGAAAGCTTCATCTCCAAGTAAT
rJMSF031B14+ ATCGGCACTACACTAGACCCCTCTTACAAATGCCCAAAGAAAGCTTCATCTCCAAGTAAT
                      ____________________________________________________________
consensus ATCGGCACTACACTAGACCCCTCTTACAAATGCCCAAAGAAAGCTTCATCTCCAAGTAAT
 
. : . : . : . : . : . :
rJMSF043C11+ CTCAACTATCCATCCCTAGCAATAGCTCAGCTCAAAGGGTCAATGGTGGTGAAAAGAACA
rJMSF032M22+ CTCAACTATCCATCCCTAGCAATAGCTCAGCTCAAAGGGTCAATGGTGGTGAAAAGAACA
rJMSF003M08+ CTCAACTATCCATCCCTAGCAATAGCTCAGCTCAAAGGGTCAATGGTGGTGAAAAGAACA
rJMSF031B14+ CTCAACTATCCATCCCTAGCAATAGCTCAGCTCAAAGGGTCAATGGTGGTGAAAAGAACA
                      ____________________________________________________________
consensus CTCAACTATCCATCCCTAGCAATAGCTCAGCTCAAAGGGTCAATGGTGGTGAAAAGAACA
 
. : . : . : . : . : . :
rJMSF043C11+ GTCACAAATGTGGGCTCAGCAAACACTACGTATTCTGTGGAGGTGAAAGCCCCAACTGGA
rJMSF032M22+ GTCACAAATGTGGGCTCAGCAAACACTACGTATTCTGTGGAGGTGAAAGCCCCAACTGGA
rJMSF003M08+ GTCACAAATGTGGGCTCAGCAAACACTACGTATTCTGTGGAGGTGAAAGCCCCAACTGGA
rJMSF031B14+ GTCACAAATGTGGGCTCAGCAAACACTACGTATTCTGTGGAGGTGAAAGCCCCAACTGGA
                      ____________________________________________________________
consensus GTCACAAATGTGGGCTCAGCAAACACTACGTATTCTGTGGAGGTGAAAGCCCCAACTGGA
 
. : . : . : . : . : . :
rJMSF043C11+ TACTCTGTCAAAATTTCTCCAACAGAGTTGAAGTTTATGGAGGTTGGAGAAAAGCAGAGT
rJMSF032M22+ TACTCTGTCAAAATTTCTCCAACAGAGTTGAAGTTTATGGAGGTTGGAGAAAAGCAGAGT
rJMSF003M08+ TACTCTGTCAAAATTTCTCCAACAGAGTTGAAGTTTATGGAGGTTGGAGAAAAGCAGAGT
rJMSF031B14+ TACTCTGTCAAAATTTCTCCAACAGAGTTGAAGTTTATGGAGGTTGGAGAAAAGCAGAGT
                      ____________________________________________________________
consensus TACTCTGTCAAAATTTCTCCAACAGAGTTGAAGTTTATGGAGGTTGGAGAAAAGCAGAGT
 
. : . : . : . : . : . :
rJMSF043C11+ TTCTTTGTAAGTGTTAAGGTTGAAAGTGTTAAGAAGGTTGGGGAGTTTGAATTTGGTTGG
rJMSF032M22+ TTCTTTGTAAGTGTTAAGGTTGAAAGTGTTAAGAAGGTTGGGGAGTTTGAATTTGGTTGG
rJMSF003M08+ TTCTTTGTAAGTGTTAAGGTTGAAAGTGTTAAGAAGGTTGGGGAGTTTGAATTTGGTTGG
rJMSF031B14+ TTCTTTGTAAGTGTTAAGGTTGAAAGTGTTAAGAAGGTTGGGGAGTTTGAATTTGGTTGG
                      ____________________________________________________________
consensus TTCTTTGTAAGTGTTAAGGTTGAAAGTGTTAAGAAGGTTGGGGAGTTTGAATTTGGTTGG
 
. : . : . : . : . : . :
rJMSF043C11+ TATAAATGGAGCGATGGGATTCACATGGTTAAGAGTCCAATTGTTGTTTCATCAGCATAG
rJMSF032M22+ TATAAATGGAGCGATGGGATTCACATGGTTAAGAGTCCAATTGTTGTTTCATCAGCATAG
rJMSF003M08+ TATAAATGGAGCGATGGGATTCACATGGTTAAGAGTCCAATTGTTGTTTCATCAGCATAG
rJMSF031B14+ TATAAATGGAGCGATGGGATTCACATGGTTAAGAGTCCAATTGTTGTTTCATCAGCATAG
                      ____________________________________________________________
consensus TATAAATGGAGCGATGGGATTCACATGGTTAAGAGTCCAATTGTTGTTTCATCAGCATAG
 
. : . : . : . : . : . :
rJMSF043C11+ CTTTCGACCTTTGGCTTTCAACTTAGGAGATTCCCAGTGAAAACCTGAAACTATTATCAC
rJMSF032M22+ CTTTCGACCTTTGGCTTTCAACTTAGGAGATTCCCAGTGAAAACCTGAAACTATTATCAC
rJMSF003M08+ CTTTCGACCTTTGGCTTTCAACTTAGGAGATTCCCAGTGAAAACCTGAAACTATTATCAC
rJMSF031B14+ CTTTCGACCTTTGGCTTTCAACTTAGGAGATTCCCAGTGAAAACCTGAAACTATTATCAC
                      ____________________________________________________________
consensus CTTTCGACCTTTGGCTTTCAACTTAGGAGATTCCCAGTGAAAACCTGAAACTATTATCAC
 
. : . : . : . : . : . :
rJMSF043C11+ AATAAATTGTCAAAACGCATGTAATAA
rJMSF032M22+ AATAAATTGTCAAACCGCATGTAATAA
rJMSF003M08+ AATAAATTGTCAAA-CGCATGTAATAATGTAGCTGGTGAAAGATGGTCAAATGGATGAAA
rJMSF031B14+ AATAAATTGTCAAA-CGCATGTAATAATGTAGCTGGTGAAAGATGGTCAAATGGATGAAA
                      ____________________________________________________________
consensus AATAAATTGTCAAA-CGCATGTAATAATGTAGCTGGTGAAAGATGGTCAAATGGATGAAA
 
. : . : . : . : . : . :
rJMSF003M08+ AGTTTTCGTTTCTTCACGGTTATGTAACA
rJMSF031B14+ AGTTTTCGTTTCTTCACGGTTATGTAACATAATTTAGTATTTATATTGTGTAACAAAATA
                      ____________________________________________________________
consensus AGTTTTCGTTTCTTCACGGTTATGTAACATAATTTAGTATTTATATTGTGTAACAAAATA