Previous Contig 012757:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012D07Sequence451005302 (4)sp|Q43644|NUAM_SOLTU1e-43NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial precursor (EC 1.6.5164012757 (2)
JMSF031A08Sequence662005302 (4)sp|Q43644|NUAM_SOLTU6e-84NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial precursor (EC 1.6.5177012757 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012D07+ NTN
                      ____________________________________________________________
consensus NTN
 
. : . : . : . : . : . :
rJMSF012D07+ TTTTTTTTTTTTTTTGGTGTGGTGTAGAGAGCACAACATTTATATCAAATGTGGGAACAA
rJMSF031A08+ TTTTTTTTTTTTTTTGTGGTGTAGAGAGCACAACATTTATATCAAATGTGGGAACAA
                      ____________________________________________________________
consensus TTTTTTTTTTTTTTTTTTGTGGTGTAGAGAGCACAACATTTATATCAAATGTGGGAACAA
 
. : . : . : . : . : . :
rJMSF012D07+ CCACATTGGTAGGCAGCCTGTTAAGGAAAATTNCAGGAAAAAAAGGTACAAACAGCAAAC
rJMSF031A08+ CCACATTGGTAGGCAGCCTGTTAAGGAAAATTACAGGAAAAAAAGGTACAAACAGCAAAC
                      ____________________________________________________________
consensus CCACATTGGTAGGCAGCCTGTTAAGGAAAATTACAGGAAAAAAAGGTACAAACAGCAAAC
 
. : . : . : . : . : . :
rJMSF012D07+ CAAAATTACATTGCCATTT
rJMSF031A08+ CAAAATTACATTGCCATTTATGNGAATTTTANGTATGGCACTAAGGCTTCAGGTCTGCTG
                      ____________________________________________________________
consensus CAAAATTACATTGCCATTTATGNGAATTTTANGTATGGCACTAAGGCTTCAGGTCTGCTG