Previous Contig 012755:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031A04Sequence621012755 (2)pir|A85041|A850413e-51probable receptor kinase [imported] - Arabidopsis thaliana>gb:AC005275_1532354 A
JMSF047J22Sequence696003194 (4)pir|A85041|A850414e-41probable receptor kinase [imported] - Arabidopsis thaliana>gb:AC005275_1532354 A692012755 (2)pir|A85041|A850413e-70probable receptor kinase [imported] - Arabidopsis thaliana>gb:AC005275_1532354 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047J22+ CACCAGGACTCGAGGTTGAGGATCATTCATAGGGATCTTAAAGCTAGCAACA
                      ____________________________________________________________
consensus CACCAGGACTCGAGGTTGAGGATCATTCATAGGGATCTTAAAGCTAGCAACA
 
. : . : . : . : . : . :
rJMSF047J22+ TTTTATTAGATCAAGAGATGAACCCTAAGATTTCAGATTTCGGGCTGGCAAGAATCGTTG
rJMSF031A04+ TCGGGCTGGCAAGAATCGTNG
                      ____________________________________________________________
consensus TTTTATTAGATCAAGAGATGAACCCTAAGATTTCAGATTTCGGGCTGGCAAGAATCGTTG
 
. : . : . : . : . : . :
rJMSF047J22+ AAGGAAAAAGTATAGAAGCCAATACAAACAAAGTTGTTGGAACTCTGGGATATATGCCTC
rJMSF031A04+ AAGGAAAAAGTATAGAAGCCAATACAAACAAAGTTGTTGGAACTNTGGGATATATGCCTC
                      ____________________________________________________________
consensus AAGGAAAAAGTATAGAAGCCAATACAAACAAAGTTGTTGGAACTCTGGGATATATGCCTC
 
. : . : . : . : . : . :
rJMSF047J22+ CGGAATATGCACTGGAGGGGCTCTTCTCAATCAAATCTGATGTTTTTAGTTTCGGTGTGG
rJMSF031A04+ CGGAATATGCACTGGAGGGGCTCTTCTCAATCAAATCTGATGTTTTTAGTTTCGGTGTGG
                      ____________________________________________________________
consensus CGGAATATGCACTGGAGGGGCTCTTCTCAATCAAATCTGATGTTTTTAGTTTCGGTGTGG
 
. : . : . : . : . : . :
rJMSF047J22+ TTGTACTTGAGATCATTAGTGGAAGGAAAAACACATCATTTTTCCAATCTCAAGAATCCT
rJMSF031A04+ TTGTACTTGAGATCATTAGTGGAAGGAAAAACACATCATTTTTCCAATCTCAAGAATCCT
                      ____________________________________________________________
consensus TTGTACTTGAGATCATTAGTGGAAGGAAAAACACATCATTTTTCCAATCTCAAGAATCCT
 
. : . : . : . : . : . :
rJMSF047J22+ TGAACCTCTTAGGCCATGCATGGAAGTTTTGGATGGAAGAGAAAGCAGTGGATATGATGG
rJMSF031A04+ TGAACCTCTTAGGCCATGCATGGAAGTNTNGGATGGAAGAGAAAGCAGTGGATATGATGG
                      ____________________________________________________________
consensus TGAACCTCTTAGGCCATGCATGGAAGTTTTGGATGGAAGAGAAAGCAGTGGATATGATGG
 
. : . : . : . : . : . :
rJMSF047J22+ ATCCGGTTCTGGTCTCTTCTTGCAACCAAAGTGAAGTGTTGAGGTGCATAAATGTGGGGC
rJMSF031A04+ ATCCGGTTCTGGTCTCTTCTTGCAACCAAAGTGAAGTGTTGAGGTGCATAAATGTGGGGC
                      ____________________________________________________________
consensus ATCCGGTTCTGGTCTCTTCTTGCAACCAAAGTGAAGTGTTGAGGTGCATAAATGTGGGGC
 
. : . : . : . : . : . :
rJMSF047J22+ TATTATGCGTGCAAGAAGATCCAAACGACCGGCCAACAATGTCGAATGTTGTTATAATGC
rJMSF031A04+ TATTATGCGTGCAAGAAGATCCAAACGACCGGCCAACAATGTCGAATGTTGTTATAATGC
                      ____________________________________________________________
consensus TATTATGCGTGCAAGAAGATCCAAACGACCGGCCAACAATGTCGAATGTTGTTATAATGC
 
. : . : . : . : . : . :
rJMSF047J22+ TAGCGACTGAAAACATGAGTGTTCCACCGCCGAAGCAGCCAGCTTTTGTAGCAAGGCGGC
rJMSF031A04+ TAGCGACTGAAAACATGAGTGTTCCACCGCCGAAGCAGCCAGCTTTTGTAGCAAGGCGGC
                      ____________________________________________________________
consensus TAGCGACTGAAAACATGAGTGTTCCACCGCCGAAGCAGCCAGCTTTTGTAGCAAGGCGGC
 
. : . : . : . : . : . :
rJMSF047J22+ GTATTTCTGAAACGCCATCTTCTTCTTCGTCCAAGATCACCGCCGAATCCCACAATGAGT
rJMSF031A04+ GTATTTCTGAAACGCCATCTTCTTCTTCGTCCAAGATCACCGCCGAATCCCACAATGAGT
                      ____________________________________________________________
consensus GTATTTCTGAAACGCCATCTTCTTCTTCGTCCAAGATCACCGCCGAATCCCACAATGAGT
 
. : . : . : . : . : . :
rJMSF047J22+ TGACTATTTCAATGGTGGGTCGATAGTTAACCAATCAATACTCTTTTGATATGATTATCT
rJMSF031A04+ TGACTATTTCAATGGTGGGTCGATAGTTAACCAATCAATACTCTTTNGATATGATTATCT
                      ____________________________________________________________
consensus TGACTATTTCAATGGTGGGTCGATAGTTAACCAATCAATACTCTTTTGATATGATTATCT
 
. : . : . : . : . : . :
rJMSF047J22+ CAAACCAACCAATTTAAAATCAGTAAAGATGTATGAGATT
rJMSF031A04+ CAAACCAACCAATTTAAAATCAGTAAAGATGTATGAGATTTTAATGTTGGTGAAAGAGCA
                      ____________________________________________________________
consensus CAAACCAACCAATTTAAAATCAGTAAAGATGTATGAGATTTTAATGTTGGTGAAAGAGCA