Previous Contig 012753:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012G16Sequence576012753 (25)gb:AY085076_15701581e-19Arabidopsis thaliana clone 126586 mRNA, complete sequence.768012753 (25)gb:AC133333_17413392e-83Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMFF042B04Sequence618012753 (25)gb:AY085076_15701581e-25Arabidopsis thaliana clone 126586 mRNA, complete sequence.593012753 (25)pir|H96569|H965691e-39unknown protein, 54928-56750 [imported] - Arabidopsis thaliana>gb:AE005173_89319
JMSF014K10Sequence414012753 (25)769009165 (11)gb:AB110185_15268986e-74Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMSF017C22Sequence234012753 (25)792012753 (25)gb:AC133333_17413392e-85Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF024F07Sequence648012753 (25)gb:AY085076_15701586e-31Arabidopsis thaliana clone 126586 mRNA, complete sequence.769012753 (25)gb:AC133333_17413397e-80Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF030C06Sequence636012753 (25)gb:AY085076_15701587e-19Arabidopsis thaliana clone 126586 mRNA, complete sequence.761012753 (25)gb:AC133333_17413394e-62Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF030P05Sequence106019650652012753 (25)pir|H96569|H965699e-22unknown protein, 54928-56750 [imported] - Arabidopsis thaliana>gb:AE005173_89319
JMSF032F10Sequence650012753 (25)gb:AY085076_15701586e-31Arabidopsis thaliana clone 126586 mRNA, complete sequence.759012753 (25)gb:AC133333_17413391e-75Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF039E11Sequence619012753 (25)gb:AY085076_15701589e-29Arabidopsis thaliana clone 126586 mRNA, complete sequence.918012753 (25)gb:AC133333_1741339e-111Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF039I18Sequence638012753 (25)gb:AY085076_15701584e-31Arabidopsis thaliana clone 126586 mRNA, complete sequence.870012753 (25)gb:AC133333_17413395e-93Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF039M14Sequence862012753 (25)gb:AC133333_1741339e-112Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF042A23Sequence669012753 (25)gb:AY085076_15701582e-28Arabidopsis thaliana clone 126586 mRNA, complete sequence.708012753 (25)pir|H96569|H965697e-58unknown protein, 54928-56750 [imported] - Arabidopsis thaliana>gb:AE005173_89319
JMSF046P08Sequence721012753 (25)gb:AY085076_15701585e-33Arabidopsis thaliana clone 126586 mRNA, complete sequence.702012753 (25)gb:AC133333_17413392e-71Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.
JMSF048F20Sequence659012753 (25)gb:AY085076_15701581e-36Arabidopsis thaliana clone 126586 mRNA, complete sequence.799012753 (25)gb:AC133333_17413395e-85Oryza sativa chromosome 3 BAC OJ1785_A05 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014K10- AGATGCACAGTCTCCCATATAAAACTCGAGC
JMSF046P08- GGGAACACTTGATCAGATGCACAGTCTCCCATATAAAACTCGAGC
                      ____________________________________________________________
consensus GGGAACACTTGATCAGATGCACAGTCTCCCATATAAAACTCGAGC
 
. : . : . : . : . : . :
JMSF030C06- CTCGGAGAAACTCAGTGGGATCGTGATCACTGATCAG
JMSF032F10- GGACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF024F07- GAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF042A23- GACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF014K10- GAGTCTCTCACATGGCGGCTCGACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF017C22- GGACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF046P08- GAGTCTCTCACATGGCGGCTCGACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF039E11- GGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMFF042B04- GACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMFF012G16- CTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF039I18- GGACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
JMSF048F20- GGACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
                      ____________________________________________________________
consensus GAGTCTCTCACATGGCGGCTGGACTCGGAGAAACTCAGTGGAATCGTGATCACTGATCAG
 
. : . : . : . : . : . :
JMSF030C06- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF032F10- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF024F07- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF042A23- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF014K10- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF017C22- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF046P08- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF039E11- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMFF042B04- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMFF012G16- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF039I18- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
JMSF048F20- CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
                      ____________________________________________________________
consensus CAATCTCTCCGTTTCCTCCACAAATGGCCACCATTAACGGCCTGCCCACGCCTCAAACCC
 
. : . : . : . : . : . :
JMSF030C06- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF032F10- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF024F07- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF042A23- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF014K10- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF017C22- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF046P08- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF039E11- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMFF042B04- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMFF012G16- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF039I18- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
JMSF048F20- TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
                      ____________________________________________________________
consensus TCCGTTCTCTATCCAAACCCAACCCAAAGACCGGTTCCCCATCCCACTTCAAGCCGACCA
 
. : . : . : . : . : . :
JMSF030C06- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF032F10- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF024F07- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF042A23- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF014K10- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF017C22- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAANGAGC
JMSF046P08- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF039E11- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMFF042B04- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMFF012G16- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF039I18- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
JMSF048F20- AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
                      ____________________________________________________________
consensus AGCTCCAGCTATTCCCCAGGCCGGTTTCCAAGCAGTTTGCGGCCGCGGCGGCGAAGGAGC
 
. : . : . : . : . : . :
JMSF030C06- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF032F10- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF024F07- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF042A23- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF014K10- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF017C22- TGGACGTGATTCCG
JMSF046P08- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF039E11- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMFF042B04- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMFF012G16- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF039I18- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
JMSF048F20- TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
                      ____________________________________________________________
consensus TGGACGTGATTCCGGTGCAGAGCAGCGACAGCACGGACCAGCAAGGCGGCGTCGTCGACG
 
. : . : . : . : . : . :
JMSF030C06- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF032F10- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF024F07- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF042A23- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF014K10- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF046P08- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF039E11- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMFF042B04- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMFF012G16- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF039I18- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
JMSF048F20- CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
                      ____________________________________________________________
consensus CCACCGAGAGAGAGGCCGAGGGCGGTGGCGATATTGACAGTATCGTGAATCAGGTGGTGG
 
. : . : . : . : . : . :
JMSF030C06- TGGTGGGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMSF032F10- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMSF024F07- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMSF042A23- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMSF014K10- TGGT-GGGTGGGTTTGGAAATGA
JMSF046P08- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMSF039E11- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMFF042B04- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMFF012G16- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMSF039I18- TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
JMSF048F20- TGGT-GGGTGGGTTTGTAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
                      ____________________________________________________________
consensus TGGT-GGGTGGGTTTGGAAATGAAGGGCGGCTGTCGTTCGAAGGGCCCACCGGGTTTGGC
 
. : . : . : . : . : . :
JMSF030C06- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCNAGCGGCGGCGCCGGANAANAGTTGGGT
JMSF032F10- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGANAAGAGTTGGGT
JMSF024F07- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGANAAGAGTTGGGT
JMSF042A23- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCNAGCGGCGGCGCCGGANAANAGTTGGGT
JMSF046P08- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGAGAAGAGTTGGGT
JMSF039E11- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGAGAAGAGTTGGGT
JMFF042B04- TCCTCTTCGCCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGAGAAGAGTTGGGT
JMFF012G16- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGAGAAGAGTTGGGT
JMSF039I18- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGAGAAGAGTTGGGT
JMSF048F20- TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGAGAAGAGTTGGGT
                      ____________________________________________________________
consensus TCCTCTTCGTCGTCGTCGTCGGCGGCTTCTTCGAGCGGCGGCGCCGGAGAAGAGTTGGGT
 
. : . : . : . : . : . :
JMSF030C06- ATGGAGAAGGTTGTTGATANAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMSF032F10- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMSF024F07- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMSF042A23- ATGGAGAANGTTGTTGATANAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMSF046P08- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMSF039E11- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMFF042B04- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMFF012G16- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMSF039I18- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
JMSF048F20- ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
                      ____________________________________________________________
consensus ATGGAGAAGGTTGTTGATAGAGCTATCAACGCTACCATTGTTTTGGCCGCCGGCACTTTC
 
. : . : . : . : . : . :
JMSF030C06- GCTATCACTAANCTGCTCACCATANACCATAACTACTGGNATGGATGGACCCTCTTTGAN
JMSF032F10- GCTATCACTAANCTGCTCACCATANACCATAACTACTGGCATGGATGGACCCTCTTTGAG
JMSF024F07- GCTATCACTAAGCTGCTCACCATANACCATAACTACTGGCATGGATGGACCCTCTTTGAG
JMSF042A23- NCTATCACTAANCTGCTCACCATANACCATAACTACTGGCATGGATGGACCCTCTTTGAN
JMSF046P08- GCTATCACTAAGCTGCTCACCATANACCATAACTACTGGCATGGATGGACCCTCTTTGAG
JMSF039E11- GCTATCACTAAGCTGCTCACCATAGACCATAACTACTGGCATGGATGGACCCTCTTTGAG
JMFF042B04- GCTATCACTAAGCTGCTCACCATAGACCATAACTACTGGCATGGATGGACCCTCTTTGAG
JMFF012G16- GCTATCACTAAGCTGCTCACCATAGACCATAACTACTGGCATGGATGGACCCTCTTTG
JMSF039I18- GCTATCACTAAGCTGCTCACCATAGACCATAACTACTGGCATGGATGGACCCTCTTTGAG
JMSF048F20- GCTATCACTAAGCTGCTCACCATAGACCATAACTACTGGCATGGATGGACCCTCTTTGAG
rJMSF039M14+ ACCATAGACCATAACTACTGGCATGGATGGACCCTCTTTGAG
rJMSF039E11+ ATAGACCATAACTACTGGCATGGATGGACCCTCTTTGAG
                      ____________________________________________________________
consensus GCTATCACTAAGCTGCTCACCATAGACCATAACTACTGGCATGGATGGACCCTCTTTGAG
 
. : . : . : . : . : . :
JMSF030C06- ATATTGAGGTATGCACCCCANCACAACTGGANTGCATATGANGAANCGCTTAAA
JMSF032F10- ATATTGAGGTATGCACCCCANCACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAA-
JMSF024F07- ATATTGAGGTATGCACCCCANCACAACTGGAGTGCATATGANGAANCGCTTAAAGAAAA-
JMSF042A23- ATATTGAGGTATGCACCCCANCACAACTGGANTGCATATGANGAANCGCTTAAANAAAA-
JMSF046P08- ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAA-
JMSF039E11- ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATGAGGA
JMFF042B04- ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATG
JMSF039I18- ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAA
JMSF048F20- ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAA-
rJMSF039M14+ ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAA-
rJMSF039E11+ ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAA-
rJMSF039I18+ ACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAAN
                      ____________________________________________________________
consensus ATATTGAGGTATGCACCCCAGCACAACTGGAGTGCATATGAGGAAGCGCTTAAAGAAAA-
 
. : . : . : . : . : . :
JMSF032F10- -CCCCGTTTTGGC
JMSF024F07- -CCCCGTTTTGGC
JMSF042A23- -CCCCGTTTTGGC
JMSF046P08- -CCCCGTTTTGGCGAA
JMSF048F20- -CCCCGTTTTGGCGAA
rJMSF039M14+ -CCCCGTTTTGGCGAAGATGGTGATAAGTGGAGTGGTTTATTCTCTAGGGGATTGGATAG
rJMSF039E11+ -CCCCGTTTTGGCGAAGATGGTGATAAGTGGAGTGGTTTATTCTCTAGGGGATTGGATAG
rJMFF012G16+ TCTAGGGGATTGGATAG
rJMSF048F20+ TGGAGTGGTTT-TTCTCTAGGGGATTGGATAG
rJMSF017C22+ AAGATGGTGATAAGTGGAGT-GNTTATTCTCTAGGGGATTGGATAG
rJMSF039I18+ CCCCCGTTTTGGCGAAGATGGTGATAAGTGGAGTGGTTTATTCTCTAGGGGATTGGATAG
                      ____________________________________________________________
consensus -CCCCGTTTTGGCGAAGATGGTGATAAGTGGAGTGGTTTATTCTCTAGGGGATTGGATAG
 
. : . : . : . : . : . :
rJMSF039M14+ CTCAGTGCTATGAAGGGAAACCGCTTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMSF039E11+ CTCAGTGCTATGAAGGGAAACCGCTTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMFF012G16+ CTCAGTGCTATGAAGGGAAACCGCTTTTNGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMSF048F20+ CTCAGTGCTATGAAGGGAAACCGCTTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMSF046P08+ TCGTGCACGCATGTTCAGATCA
rJMSF017C22+ CTCAGTGCTATGAAGGGAAACCGCTTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMSF024F07+ CTCAGTGCTATGAAGGGAAACCGCNTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMSF039I18+ CTCAGTGCTATGAAGGGAAACCGCTTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMSF032F10+ AACCGCNTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
rJMSF030C06+ CCGCTTTTTGAATTTTGATCGTGCACGCATGTTCAGATCA
                      ____________________________________________________________
consensus CTCAGTGCTATGAAGGGAAACCGCTTTTTGAA-TTTGATCGTGCACGCATGTTCAGATCA
 
. : . : . : . : . : . :
rJMSF039M14+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMSF039E11+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMFF012G16+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMSF048F20+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMSF046P08+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTANTACTATCAC-TTCTGTGA
rJMSF017C22+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMSF024F07+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMSF039I18+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMSF042A23+ CTACATGGATCCTTATCTCACTATTACTATCACTTTCTGTGA
rJMSF032F10+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
rJMSF030C06+ GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
                      ____________________________________________________________
consensus GGTCTAACTGGATTTACACTACATGGATCCTTATCTCACTATTACTATCAC-TTCTGTGA
 
. : . : . : . : . : . :
rJMSF039M14+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF039E11+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMFF012G16+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF048F20+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF046P08+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF017C22+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF024F07+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF039I18+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF042A23+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCATTTTGATCAAA
rJMSF032F10+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
rJMSF030C06+ GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
                      ____________________________________________________________
consensus GGCACTCTTTCCTTTTGATGATTGGTGGGTGGTACCTGCCAAAGTTGCA-TTTGATCAAA
 
. : . : . : . : . : . :
rJMSF039M14+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF039E11+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMFF012G16+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF048F20+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF046P08+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF017C22+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF024F07+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF039I18+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF042A23+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF032F10+ CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMSF030C06+ CTGTTTTAGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
rJMFF042B04+ TTCACAGTTCTTGGATTTTTACGTCTT
                      ____________________________________________________________
consensus CTG-TTTGGTCAGCAATTTGGAACAGCATTTACTTCACAGTTCTTGGATTTTTACGTCTT
 
. : . : . : . : . : . :
rJMSF039M14+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF039E11+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMFF012G16+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF048F20+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF046P08+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF017C22+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF024F07+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF039I18+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF042A23+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF032F10+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMSF030C06+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
rJMFF042B04+ GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
                      ____________________________________________________________
consensus GAATCCCCTACCAGTATCTTCAGTGAACTAAAGGCAACATTTTGGCCCATGCTTACGGCA
 
. : . : . : . : . : . :
rJMSF039M14+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF039E11+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMFF012G16+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF048F20+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF046P08+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF017C22+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF024F07+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF039I18+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF042A23+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF032F10+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF030C06+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMFF042B04+ GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
rJMSF030P05+ GAAACTNTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGNTGAGCAG
                      ____________________________________________________________
consensus GGCTGGAAACTTTGGCCATTTGCTCATCTAATTACCTATGGCGTGATCCCCGTTGAGCAG
 
. : . : . : . : . : . :
rJMSF039M14+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF039E11+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMFF012G16+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF048F20+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF046P08+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF017C22+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF024F07+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF039I18+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF042A23+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF032F10+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF030C06+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCT--ACTTACTCG
rJMFF042B04+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
rJMSF030P05+ AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
                      ____________________________________________________________
consensus AGACTGCTTTGGGTTGACTGTGTAGAGCTCATTTGGGTTACAATACTCTCAACTTACTCG
 
. : . : . : . : . : . :
rJMSF039M14+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF039E11+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMFF012G16+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTCGAAGCAACTTCCAACCCTCCC
rJMSF048F20+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF046P08+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF017C22+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF024F07+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF039I18+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF042A23+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF032F10+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF030C06+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMFF042B04+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
rJMSF030P05+ AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
                      ____________________________________________________________
consensus AATGAGAAGTCAGAAGCTAGAATATCCGAGGAATCAGTGGAAGCAACTTCCAACCCTCCC
 
. : . : . : . : . : . :
rJMSF039M14+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF039E11+ TCTGTAGGCCCATCTC---AGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMFF012G16+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF048F20+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF046P08+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF017C22+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF024F07+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF039I18+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF042A23+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF032F10+ TCTGTAGGCCCATCTC---AGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF030C06+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMFF042B04+ TCTGTAGGCCCATCTC---AGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
rJMSF030P05+ TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
                      ____________________________________________________________
consensus TCTGTAGGCCCATCTCAGAAGTAAACGGATAGAAAACCAAGAAGCGGGGAAAAGATTGGA
 
. : . : . : . : . : . :
rJMSF039M14+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF039E11+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMFF012G16+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF048F20+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF046P08+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF017C22+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF024F07+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF039I18+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF042A23+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF032F10+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF030C06+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMFF042B04+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
rJMSF030P05+ GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
                      ____________________________________________________________
consensus GGAAGAAGTGTTTGTGTGCTCCTATTCCTATCTAGCGATAGCATCCTCTTTGTTGAGGGC
 
. : . : . : . : . : . :
rJMSF039M14+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF039E11+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMFF012G16+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF048F20+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF046P08+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF017C22+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF024F07+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF039I18+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF042A23+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF032F10+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF030C06+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMFF042B04+ CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
rJMSF030P05+ CGTGGCTTTGGTATATNTGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
                      ____________________________________________________________
consensus CGTGGCTTTGGTATATATGAATGGCGGCGTCAAGGTAAATATGGCTGGAGAAAAATGGGT
 
. : . : . : . : . : . :
rJMSF039M14+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-C
rJMSF039E11+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMFF012G16+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF048F20+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF046P08+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATACCATATCATGTATACTACC
rJMSF017C22+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF024F07+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF039I18+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF042A23+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF032F10+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF030C06+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMFF042B04+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
rJMSF030P05+ GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
                      ____________________________________________________________
consensus GTGCTATATCTCTCAAGTCTCAACTCCATTTGTAATCTATA-CATA-CATGTATACTACC
 
. : . : . : . : . : . :
rJMSF039E11+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCCTGGAATGAAAAA
rJMFF012G16+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCT
rJMSF048F20+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCTTGGAATGTAAAAATGTA
rJMSF046P08+ CTTTCCTCTCTTTGTAAGCAAAA
rJMSF017C22+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGT
rJMSF024F07+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTACCCTTGGAATGTAAAAATGTA
rJMSF039I18+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTACCCTTGGAATGTAAAAATGTAGTC
rJMSF042A23+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCTTGGAATGTAAAAATGTAGTCTC
rJMSF032F10+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCTTGGAATGTAAAAATGTAGTCTC
rJMSF030C06+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCTTGGAATGTAAAAATGTAGTCTC
rJMFF042B04+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCTTGGAATGTAAAAATGTAGTCTC
rJMSF030P05+ CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCTTGGAATGTAAAAATGTAGTCTC
                      ____________________________________________________________
consensus CTTTCCTCTCTTTGTAAGCAAAAAGTCTTCAGTA-CCTTGGAATGTAAAAATGTAGTCTC
 
. : . : . : . : . : . :
rJMSF042A23+ AATC
rJMSF032F10+ AATCT
rJMSF030C06+ AATCT
rJMFF042B04+ AATCTTAACTAATTTAT
rJMSF030P05+ AATCTTAACTAATTTATTCATACTAATCTTAGGGAACACTTACAGCATGTTTGGTTCACG
                      ____________________________________________________________
consensus AATCTTAACTAATTTATTCATACTAATCTTAGGGAACACTTACAGCATGTTTGGTTCACG
 
. : . : . : . : . : . :
rJMSF030P05+ GAATGAATTTTGAGGTAATAGGAATGCTATTCCATAAGGAATGAAATAGGCAAGGAATAA
                      ____________________________________________________________
consensus GAATGAATTTTGAGGTAATAGGAATGCTATTCCATAAGGAATGAAATAGGCAAGGAATAA
 
. : . : . : . : . : . :
rJMSF030P05+ AATTGTTCAAAATCGTAGTATGAAGAATGAAAAAGGACTTGAATTGTGTATTTGTGTGTT
                      ____________________________________________________________
consensus AATTGTTCAAAATCGTAGTATGAAGAATGAAAAAGGACTTGAATTGTGTATTTGTGTGTT