Previous Contig 012751:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006D20Sequence353004501 (2)pir|F84428|F844286e-20probable myosin heavy chain-like protein [imported] - Arabidopsis thaliana>gb:AC726012751 (4)pir|G96703|G967033e-56unknown protein, 30164-32998 [imported] - Arabidopsis thaliana>gb:AE005173_89442
JMFF011L23Sequence505006699 (8)gb:AY128287_15805882e-30Arabidopsis thaliana At1g68060/T23K23_9 mRNA, complete cds.>gb:BT000826_1635081 738012751 (4)gb:AY128287_15805883e-07Arabidopsis thaliana At1g68060/T23K23_9 mRNA, complete cds.>gb:BT000826_1635081
JMSF030O18Sequence549006699 (8)pir|C86282|C862825e-07protein F10B6.24 [imported] - Arabidopsis thaliana>gb:AE005172_890481 Arabidopsi768012751 (4)gb:AY128287_15805880.016Arabidopsis thaliana At1g68060/T23K23_9 mRNA, complete cds.>gb:BT000826_1635081
JMSF033L15Sequence176006699 (8)760012751 (4)gb:AP004880_18465194e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006D20+ TTTTGCCCAAGCGATCACCGTCCTTTCAAATGAGGTCTTCTGGGATCAGTT
                      ____________________________________________________________
consensus TTTTGCCCAAGCGATCACCGTCCTTTCAAATGAGGTCTTCTGGGATCAGTT
 
. : . : . : . : . : . :
rJMFF006D20+ CTGTCCCTGAAGCATGCGAAAGGGACATCAAAGTCATTTGATGGTGGCTCAAGGTCATTG
                      ____________________________________________________________
consensus CTGTCCCTGAAGCATGCGAAAGGGACATCAAAGTCATTTGATGGTGGCTCAAGGTCATTG
 
. : . : . : . : . : . :
rJMFF006D20+ GACCGAGGTAAAAACCTTCTTAGTGGAACTGGTCCAAATTTTAAGCTCACTCAGTCCTGT
                      ____________________________________________________________
consensus GACCGAGGTAAAAACCTTCTTAGTGGAACTGGTCCAAATTTTAAGCTCACTCAGTCCTGT
 
. : . : . : . : . : . :
rJMFF006D20+ GATGGAGCTAAGGATAGTGGGCCTGAAAATAAATGGAAAGAAAATCAAGATGAAAAGCCC
                      ____________________________________________________________
consensus GATGGAGCTAAGGATAGTGGGCCTGAAAATAAATGGAAAGAAAATCAAGATGAAAAGCCC
 
. : . : . : . : . : . :
rJMFF006D20+ AATGACTTGCAAGTAACAGAAACAGAGGATACTGTCCCGGGAGTATTACACGATTTGCTA
                      ____________________________________________________________
consensus AATGACTTGCAAGTAACAGAAACAGAGGATACTGTCCCGGGAGTATTACACGATTTGCTA
 
. : . : . : . : . : . :
rJMFF006D20+ CAAAAGGAGGTGGTTTCCTTGAGAAAAGCATGTCATGAAAAGGATCAAAGTCTAAAAGAC
                      ____________________________________________________________
consensus CAAAAGGAGGTGGTTTCCTTGAGAAAAGCATGTCATGAAAAGGATCAAAGTCTAAAAGAC
 
. : . : . : . : . : . :
rJMFF006D20+ AAGGATGATGCAATTGAGATGCTAGCCAAGAAAGTAGAGACTCTAACAAAAGCAATGGAA
rJMSF033L15+ GGATGATGCTATAGAGATGTTAGCTAAGAAAGTAGACACTCTAACAAAAGCAATGGAA
rJMFF011L23+ AAAAGCAATGGAA
                      ____________________________________________________________
consensus AAGGATGATGCTATTGAGATGTTAGCTAAGAAAGTAGAGACTCTAACAAAAGCAATGGAA
 
. : . : . : . : . : . :
rJMFF006D20+ GTTGAGGCTAAAAAAATGAGAAGGGAAGTTGCTGCAATGGAAAAGGAGGTTGCTGCGATA
rJMSF033L15+ GTTGAGGCTAAAAAAATGAGAAGGGAGGTTGCTGCCATGGAGAAGGAGGTGGCTGCAATG
rJMFF011L23+ GTTGAGGCTAAAAAAATGAGAAGGGAGGTTGCTGCCATGGAGAAGGAGGTGGCTGCAATG
rJMSF030O18+ AAAATGAGAAGGGAGGTTGCTGCCATGGAGAAGGAGGTGGCTGCCATG
                      ____________________________________________________________
consensus GTTGAGGCTAAAAAAATGAGAAGGGAGGTTGCTGCCATGGAGAAGGAGGTGGCTGCAATG
 
. : . : . : . : . : . :
rJMFF006D20+ CGAGTGGAGAGGGAACAAGAAAATAGGGCCAATCGACTTGGAAATTCAAGGGGTTCTGTC
rJMSF033L15+ CGAGTGGATAAGGAACATGACAATAGGGCAAAACAATTTGGAAATTCCAAGGGTCCTGTC
rJMFF011L23+ CGAGTGGATAAGGAACATGACAATAGGGCAAAACAATTTGGAAATTCCAAGGGTCCTGTC
rJMSF030O18+ CGAGTGGATAAGGAACATGACAATAGGGCAAANCAATTTGGAAATTCCAAGGGTCCTGTC
                      ____________________________________________________________
consensus CGAGTGGATAAGGAACATGACAATAGGGCAAAACAATTTGGAAATTCCAAGGGTCCTGTC
 
. : . : . : . : . : . :
rJMFF006D20+ AACAGTTCTCAG
rJMSF033L15+ AACAGTTCTCAGCTCCTTCCTGGAAGGACTGTAGCTAGAAGTGGAGTAACACGCAGCATG
rJMFF011L23+ AACAGTTCTCAGCTCCTTCCTGGAAGGACTGTAGCTAGAAGTGGAGTAACACGCAGCATG
rJMSF030O18+ AACAGTTCTCAGCTCCTTCCTGGAAGGACTGTAGCTAGAAGTGGAGTAACACGCAGCATG
                      ____________________________________________________________
consensus AACAGTTCTCAGCTCCTTCCTGGAAGGACTGTAGCTAGAAGTGGAGTAACACGCAGCATG
 
. : . : . : . : . : . :
rJMSF033L15+ CAATAGTAGTAAGGAAACTCCCCGAGTACTGCTGTAAGAAGCAATTATGCATAGATTGGC
rJMFF011L23+ CAATAGTAGTAAGGAAACTCCCCGAGTACTGCTGTAAGAAGCAATTATGCATAGATTGGC
rJMSF030O18+ CAATAGTAGTAAGGAAACTCCCCGAGTACTGCTGTAAGAAGCAATTATGCATAGATTGGC
                      ____________________________________________________________
consensus CAATAGTAGTAAGGAAACTCCCCGAGTACTGCTGTAAGAAGCAATTATGCATAGATTGGC
 
. : . : . : . : . : . :
rJMSF033L15+ CTCTGCTCTAAATTACTTATCCATTATCCTATTCCACCCCTTATATTGTTTATTGTAAAA
rJMFF011L23+ CTCTGCTCTAAATTACTTATCCATTATCCTATTCCACCCCTTATATTGTTTATTGTAAAA
rJMSF030O18+ CTCTGCTCTAAATTACTTATCCATTATCCTATTCCACCCCTTATATTGTTTATTGTAAAA
                      ____________________________________________________________
consensus CTCTGCTCTAAATTACTTATCCATTATCCTATTCCACCCCTTATATTGTTTATTGTAAAA
 
. : . : . : . : . : . :
rJMSF033L15+ TCATAACAAAGCATGAAAAACGACTTTGATCGATCGATCCCTCTGCTCTAGTGGGGAATG
rJMFF011L23+ TCATAACAAAGCATGAAAAACGACTTTGATCGATCGATCCCTCTGCTCTAGTGGGGAATG
rJMSF030O18+ TCATAACAAAGCATGAAAAACGACTTTGATCGATCGATCCCTCTGCTCTAGTGGGGAATG
                      ____________________________________________________________
consensus TCATAACAAAGCATGAAAAACGACTTTGATCGATCGATCCCTCTGCTCTAGTGGGGAATG
 
. : . : . : . : . : . :
rJMSF033L15+ TGAAAAATTAGTCGAGCAGCAGAGAAAACCAATATAGATGGATTTGGTGTATTTCCAAGT
rJMFF011L23+ TGAAAAATTAGTCGAGCAGCAGAGAAAACCAATATAGATGGATTTGGTGTATTTCCAAGT
rJMSF030O18+ TGAAAAATTAGTCGAGCAGCAGAGAAAACCAATATAGATGGATTTGGTGTATTTCCAAGT
                      ____________________________________________________________
consensus TGAAAAATTAGTCGAGCAGCAGAGAAAACCAATATAGATGGATTTGGTGTATTTCCAAGT
 
. : . : . : . : . : . :
rJMSF033L15+ TAGACTACTGATCCCTCTCTCCTGTCTGTCTGGTTGTGGCAACATGAAGTTTAGCTGTTA
rJMFF011L23+ TAGACTACTGATCCCTCTCTCCTGTCTGTCTGGTTGTGGCAACATGAAGTTTAGCTGTTA
rJMSF030O18+ TAGACTACTGATCCCTCTCTCCTGTCTGTCTGGTTGTGGCAACATGAAGTTTAGCTGTTA
                      ____________________________________________________________
consensus TAGACTACTGATCCCTCTCTCCTGTCTGTCTGGTTGTGGCAACATGAAGTTTAGCTGTTA
 
. : . : . : . : . : . :
rJMSF033L15+ AGGGGAGAAAACCCACCCATGGAATTCGATATATGTTTCTGACTTTAGACTGATCCCTCT
rJMFF011L23+ AGGGGAGAAAACCCACCCATGGAATTCGATATATGTTTCTGACTTTAGACTGATCCCTCT
rJMSF030O18+ AGGGGAGAAAACCCACCCATGGAATTCGATATATGTTTCTGACTTTAGACTGATCCCTCT
                      ____________________________________________________________
consensus AGGGGAGAAAACCCACCCATGGAATTCGATATATGTTTCTGACTTTAGACTGATCCCTCT
 
. : . : . : . : . : . :
rJMSF033L15+ GCTTAGAAATCACCAAGAAAAGATCAAGGTTGAGCTAACTCTCTTTTGGCTGAATGATAT
rJMFF011L23+ GCTTAGAAATCACCAAGAAAAGATCAAGGTTGAGCTAACTCTCTTTTGGCTGAATGATAT
rJMSF030O18+ GCTTAGAAATCACCAAGAAAAGATCAAGGTTGAGCTAACTCTCTTTTGGCTGAATGATAT
                      ____________________________________________________________
consensus GCTTAGAAATCACCAAGAAAAGATCAAGGTTGAGCTAACTCTCTTTTGGCTGAATGATAT
 
. : . : . : . : . : . :
rJMSF033L15+ CAGTGGCAGTGATTGCGAGGCTGTATAGGTGGCTTGATGTCATTTACTTTATCCAGCTTT
rJMFF011L23+ CAGTGGCAGTGATTGCGAGGCTGTATAGGTGGCTTGATGTCATTTACTTTATCCAGCTTT
rJMSF030O18+ CAGTGGCAGTGATTGCGAGGCTGTATAGGTGGCTTGATGTCATTTACTTTATCCAGCTTT
                      ____________________________________________________________
consensus CAGTGGCAGTGATTGCGAGGCTGTATAGGTGGCTTGATGTCATTTACTTTATCCAGCTTT
 
. : . : . : . : . : . :
rJMSF033L15+ TTTTAAAATTATTATTAAACCACGTTTGCAGTCTGTATTTGT
rJMFF011L23+ TTTTAAAATTATTATTAAACCACGTTTGCAGTCTGTATTTGTAATATGCAAGCTAGTGTG
rJMSF030O18+ TTTTAAAATTATTATTAAACCACGTTTGCAGTCTGTATTTGTAATATGCAAGCTAGTGTG
                      ____________________________________________________________
consensus TTTTAAAATTATTATTAAACCACGTTTGCAGTCTGTATTTGTAATATGCAAGCTAGTGTG
 
. : . : . : . : . : . :
rJMFF011L23+ TGATA
rJMSF030O18+ TGATATGGTTAATGGTTCCAGTTTGTCAATATTCTTGTATTGAGTGAGACTACGATCAGA
                      ____________________________________________________________
consensus TGATATGGTTAATGGTTCCAGTTTGTCAATATTCTTGTATTGAGTGAGACTACGATCAGA