Previous Contig 012745:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004P24Sequence752012745 (9)gb:AP004869_18462952e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P041
JMSF030N18Sequence657012745 (9)gb:AY079108_15681691e-60Arabidopsis thaliana At1g55840/F14J16_2 mRNA, complete cds.>gb:AF419577_1798439 689012745 (9)gb:AY079108_15681697e-34Arabidopsis thaliana At1g55840/F14J16_2 mRNA, complete cds.>gb:AF419577_1798439
JMSF039B01Sequence661012745 (9)gb:AY079108_15681692e-75Arabidopsis thaliana At1g55840/F14J16_2 mRNA, complete cds.>gb:AF419577_1798439 905012745 (9)gb:AP004869_18462953e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P041
JMSF050O05Sequence683012745 (9)gb:AY079108_15681693e-80Arabidopsis thaliana At1g55840/F14J16_2 mRNA, complete cds.>gb:AF419577_1798439 721012745 (9)pir|G96599|G965997e-27protein F14J16.8 [imported] - Arabidopsis thaliana>gb:AE005173_893462 Arabidopsi
JMSF050P14Sequence659012745 (9)gb:AY079108_15681691e-70Arabidopsis thaliana At1g55840/F14J16_2 mRNA, complete cds.>gb:AF419577_1798439 755012745 (9)gb:AP004869_18462959e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P041

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030N18- GAGATCTACAAAACAGAG
                      ____________________________________________________________
consensus GAGATCTACAAAACAGAG
 
. : . : . : . : . : . :
JMSF030N18- GCAGAAGATCTGGGAAAAGAAAAAGGAAGGAAATGTTAGTCATATTACTATAAACAGAGG
                      ____________________________________________________________
consensus GCAGAAGATCTGGGAAAAGAAAAAGGAAGGAAATGTTAGTCATATTACTATAAACAGAGG
 
. : . : . : . : . : . :
JMSF030N18- TCACAGCATCCATTGTCAGAGCTCCACCCTACCAAAGTAAAAGAATAGGAGGTGGAGAGG
JMSF050P14- AGAGCTCCACCCTACCAAAGTAAAAGAATAGGAGGTGGAGAGG
JMSF039B01- AGAGCTCCACCCTACCAAAGTAAAAGAATAGGAGGTGGAGAGG
JMSF050O05- AGAGCTCCACCCTACCAAAGTAAAAGAATAGGAGGTGGAGAGG
                      ____________________________________________________________
consensus TCACAGCATCCATTGTCAGAGCTCCACCCTACCAAAGTAAAAGAATAGGAGGTGGAGAGG
 
. : . : . : . : . : . :
JMSF030N18- AAAGTGAAATTCAAAAATCGGGTCTGAATCTAACGAACAGTTCTGGGTTTTAGAGAAAAA
JMSF050P14- AAAGTGAAATTCAAAAATCGGGTCTGAATCTAACGAACAGTTCTGGGTTTTAGAGAAAAA
JMSF039B01- AAAGTGAAATTCAAAAATCGGGTCTGAATCTAACGAACAGTTCTGGGTTTTAGAGAAAAA
JMSF050O05- AAAGTGAAATTCAAAAATCGGGTCTGAATCTAACGAACAGTTCTGGGTTTTAGAGAAAAA
                      ____________________________________________________________
consensus AAAGTGAAATTCAAAAATCGGGTCTGAATCTAACGAACAGTTCTGGGTTTTAGAGAAAAA
 
. : . : . : . : . : . :
JMSF030N18- ATGGTCTTAATTAAAGAAGAGATGATCAGGCAGTTAGGAGCTTTGATGGAAGATATTGAT
JMSF050P14- ATGGTCTTAATTAAAGAAGAGATGATCAGGCAGTTAGGAGCTTTGATGGAAGATATTGAT
JMSF039B01- ATGGTCTTAATTAAAGAAGAGATGATCAGGCAGTTAGGAGCTTTGATGGAGGATATTGAT
JMSF050O05- ATGGTCTTAATTAAAGAAGAGATGATCAGGCAGTTAGGAGCTTTGATGGAAGATATTGAT
                      ____________________________________________________________
consensus ATGGTCTTAATTAAAGAAGAGATGATCAGGCAGTTAGGAGCTTTGATGGAAGATATTGAT
 
. : . : . : . : . : . :
JMSF030N18- GAATCACTGAAGATGACTTTCAAGAATGTGCACCAAGGGTTCCCAACTGAGACTCTGGTG
JMSF050P14- GAATCACTGAAGATGACTTTCAAGAATGTGCACCAAGGGTTCCCAACTGAGACTCTGGTG
JMSF039B01- GAATCACTGAAGATGACTTTCAAGAATGTGCACCAAGGGTTCCCAACTGAGACTCTGGTG
JMSF050O05- GAATCACTGAAGATGACTTTCAAGAATGTGCACCAAGGGTTCCCAACTGAGACTCTGGTG
                      ____________________________________________________________
consensus GAATCACTGAAGATGACTTTCAAGAATGTGCACCAAGGGTTCCCAACTGAGACTCTGGTG
 
. : . : . : . : . : . :
JMSF030N18- AGGTTTCTAAAAGCAAGGGATGGAAATGTATCTAAAGCCCATAAAATGCTTACTGACTGT
JMSF050P14- AGGTTTCTAAAAGCAAGGGATGGAAATGTATCTAAAGCCCATAAAATGCTTACTGACTGT
JMSF039B01- AGGTTTCTAAAAGCAAGGGATGGAAATGTATCTAAAGCCCATAAAATGCTTACTGACTGT
JMSF050O05- AGGTTTCTAAAAGCAAGGGATGGAAATGTATCTAAAGCCCATAAAATGCTTACTGACTGT
                      ____________________________________________________________
consensus AGGTTTCTAAAAGCAAGGGATGGAAATGTATCTAAAGCCCATAAAATGCTTACTGACTGT
 
. : . : . : . : . : . :
JMSF030N18- TTGAACTGGAGGCTCCAAAATGAGATTGATAATATATTAGCTAAGCCAATTGTCCCTTCT
JMSF050P14- TTGAACTGGAGGCTCCAAAATGAGATTGATAATATATTAGCTAAGCCAATTGTCCCTTCT
JMSF039B01- TTGAACTGGAGGCTCCAAAATGAGATTGATAATATATTAGCTAAGCCAATTGTCCCTTCT
JMSF050O05- TTGAACTGGAGGCTCCAAAATGAGATTGATAATATATTAGCTAAGCCAATTGTCCCTTCT
                      ____________________________________________________________
consensus TTGAACTGGAGGCTCCAAAATGAGATTGATAATATATTAGCTAAGCCAATTGTCCCTTCT
 
. : . : . : . : . : . :
JMSF030N18- GAGTTGTACAGGGGAATTAGGGAATCTCAGCTTGTAGGGATGACTGGATACTCAAAAGAG
JMSF050P14- GAGTTGTACAGGGGAATTAGGGAATCTCAGCTTGTAGGGATGACTGGATACTCAAAAGAG
JMSF039B01- GAGTTGTACAGGGGAATTAGGGAATCTCAGCTTGTAGGGATGACTGGATACTCAAAAGAG
JMSF050O05- GAGTTGTACAGGGGAATTAGGGAATCTCAGCTTGTAGGGATGACTGGATACTCAAAAGAG
rJMSF039B01+ GTAGGGATGACTGGATACTC-AAAGAG
                      ____________________________________________________________
consensus GAGTTGTACAGGGGAATTAGGGAATCTCAGCTTGTAGGGATGACTGGATACTCAAAAGAG
 
. : . : . : . : . : . :
JMSF030N18- GGCATTCCTGTCATTGCTGTTGGTCTGGGGCTCAGCACATTTGATAGAGCATCTGTTCAC
JMSF050P14- GGCATTCCTGTCATTGCTGTTGGTCTGGGGCTCAGCACATTTGATAGAGCATCTGTTCAC
JMSF039B01- GGCATTCCTGTCATTGCTGTTGGTCTGGGGCTCAGCACATTTGATAGAGCATCTGTTCAC
JMSF050O05- GGCATTCCTGTCATTGCTGTTGGTCTGGGGCTCAGCACATTTGATAGAGCATCTGTTCAC
rJMSF039B01+ GGCATTCCTGTCATTGCTGTTGGTCTGGGGCTCAGCACATTTGATAGAGCATCTGTTCAC
                      ____________________________________________________________
consensus GGCATTCCTGTCATTGCTGTTGGTCTGGGGCTCAGCACATTTGATAGAGCATCTGTTCAC
 
. : . : . : . : . : . :
JMSF030N18- TACTATGTTCAATCACACATACNGATGAATGAATATCGTGACCGAGTCATGTTGCCTTTT
JMSF050P14- TACTATGTTCAATCACACATACAGATGAATGAATATCGTGACCGAGTCATGTTGCCTTTT
JMSF039B01- TACTATGTTCAATCACACATACAGATGAATGAATATCGTGACCGAGTCATGTTGCCTTTT
JMSF050O05- TACTATGTTCAATCACACATACAGATGAATGAATATCGTGACCGAGTCATGTTGCCTTTT
rJMSF039B01+ TACTATGTTCAATCACACATACAGATGAATGAATATCGTGACCGAGTCATGTTGCCTTTT
                      ____________________________________________________________
consensus TACTATGTTCAATCACACATACAGATGAATGAATATCGTGACCGAGTCATGTTGCCTTTT
 
. : . : . : . : . : . :
JMSF030N18- GCAACGAGAAAGTTTGGTCGGCACATTAGTACATGTATA
JMSF050P14- GCAACGAGAAAGTTTGGTCGGCACATTAGTACATGTATAAAGATATTGGACATGACTGGT
JMSF039B01- GCAACGAGAAAGTTTGGTCGGCACATTAGTACATGTATAAAGATATTGGACATGACTGGT
JMSF050O05- GCAACGAGAAAGTTTGGTCGGCACATTAGTACATGTATAAAGATATTGGACATGACTGGT
rJMSF039B01+ GCAACGAGAAAGTTTGGTCGGCACATTAGTACATGTATAAAGATATTGGACATGACTGGT
                      ____________________________________________________________
consensus GCAACGAGAAAGTTTGGTCGGCACATTAGTACATGTATAAAGATATTGGACATGACTGGT
 
. : . : . : . : . : . :
JMSF050P14- CTTAAGCTTTCTGCTCTAAATCATATTAAGCTATTGACTACTA--TCTGCCATTGATGAT
JMSF039B01- CTTAAGCTTTCTGCTCTAAATCATATTAAGCTATTGACTACTATCTCTGCCATTGATGAT
JMSF050O05- CTTAAGCTTTCTGCTCTAAATCATATTAAGCTATTGACTACTATCTCTGCCATTGATGAT
rJMSF039B01+ CTTAAGCTTTCTGCTCTAAATCATATTAAGCTATTGACTACTATCTCTGCCATTGATGAT
rJMSF050P14+ AATCATATTAAGCTATTGACTACTA--TCTGCCATTGATGAT
                      ____________________________________________________________
consensus CTTAAGCTTTCTGCTCTAAATCATATTAAGCTATTGACTACTATCTCTGCCATTGATGAT
 
. : . : . : . : . : . :
JMSF050P14- CTTAATTATCCTGA
JMSF039B01- CTTAATTATCCTGA
JMSF050O05- CTTAATTATCCTGAGAAGACCGAAGCATATTACATTGTT
rJMSF039B01+ CTTAATTATCCTGAGAAGACCGAAGCATATTACATTGTTAATGCACCATATATATTTTCA
rJMSF050P14+ CTTAATTATCCTGAGAAGACCGAAGCATATTACATTGTTAATGCACCATATATATTTTCA
rJMFF004P24+ CTGAGAAGACCGAAGCATATTACATTGTTAATGCACCATATATATTTTCA
                      ____________________________________________________________
consensus CTTAATTATCCTGAGAAGACCGAAGCATATTACATTGTTAATGCACCATATATATTTTCA
 
. : . : . : . : . : . :
rJMSF039B01+ GCATGCTGGAAGGTAGTGCGTCCTCTTCTACAAGAAAGAACGAGAAAGAAAGTTCTAGTG
rJMSF050P14+ GCATGCTGGAAGGTAGTGCGTCCTCTTCTACAAGAAAGAACGAGAAAGAAAGTTCTAGTG
rJMFF004P24+ GCATGCTGGAAGGTAGTGCGTCCTCTTCTACAAGAAAGAACGAGAAAGAAAGTTCTAGTG
rJMSF030N18+ CAAGAAAGAACGAGAAAGAAAGTTCTAGTG
                      ____________________________________________________________
consensus GCATGCTGGAAGGTAGTGCGTCCTCTTCTACAAGAAAGAACGAGAAAGAAAGTTCTAGTG
 
. : . : . : . : . : . :
rJMSF039B01+ TTGTCAGGTTCAGGAAGAGATGACCTATTGAAAATAATGGATTATGCATCTCTCCCTCAT
rJMSF050P14+ TTGTCAGGTTCAGGAAGAGATGACCTATTGAAAATAATGGATTATGCATCTCTCCCTCAT
rJMSF050O05+ ATAATGGATTATGCATCTCTCCCTCAT
rJMFF004P24+ TTGTCAGGTTCAGGAAGAGATGACCTATTGAAAATAATGGATTATGCATCTCTCCCTCAT
rJMSF030N18+ TTGTCAGGTTCAGGAAGAGATGACCTATTGAAAATAATGGATTATGCATCTCTCCCTCAT
                      ____________________________________________________________
consensus TTGTCAGGTTCAGGAAGAGATGACCTATTGAAAATAATGGATTATGCATCTCTCCCTCAT
 
. : . : . : . : . : . :
rJMSF039B01+ TTCTGTAAAAGAGAGGGCTCAGGGTCTTCTCAGCATTCTAGGAATGGTACCATCGATGAT
rJMSF050P14+ TTCTGTAAAAGAGAGGGCTCAGGGTCTTCTCAGCATTCTAGGAATGGTACCATCGATGAT
rJMSF050O05+ TTCTGTAAAAGAGAGGGCTCAGGGTCTTCTCAGCATTCTAGGAATGGTACCATCGATGAT
rJMFF004P24+ TTCTGTAAAAGAGAGGGCTCAGGGTCTTCTCAGCATTCTAGGAATGGTACCATCGATGAT
rJMSF030N18+ TTCTGTAAAAGAGAGGGCTCAGGGTCTTCTCAGCATTCTAGGAATGGTACCATCGATGAT
                      ____________________________________________________________
consensus TTCTGTAAAAGAGAGGGCTCAGGGTCTTCTCAGCATTCTAGGAATGGTACCATCGATGAT
 
. : . : . : . : . : . :
rJMSF039B01+ TGTTTTTCCTTGGACCATGACTGCCATCGGCAGCTTTATGATTATATTAAGCAGCAAGCA
rJMSF050P14+ TGTTTTTCCTTGGACCATGACTGCCATCGGCAGCTTTATGATTATATTAAGCAGCAAGCA
rJMSF050O05+ TGTTTTTCCTTGGACCATGACTGCCATCGGCAGCTTTATGATTATATTAAGCAGCAAGCA
rJMFF004P24+ TGTTTTTCCTTGGACCATGACTGCCATCGGCAGCTTTATGATTATATTAAGCAGCAAGCA
rJMSF030N18+ TGTTTTTCCTTGGACCATGACTGCCATCGGCAGCTTTATGATTATATTAAGCAGCAAGCA
                      ____________________________________________________________
consensus TGTTTTTCCTTGGACCATGACTGCCATCGGCAGCTTTATGATTATATTAAGCAGCAAGCA
 
. : . : . : . : . : . :
rJMSF039B01+ GAGCTTGTGGAGCCCGCTGGACTAATCAAAGAAGGGTCGTTCCATGTTGCTGTCCCTGAA
rJMSF050P14+ GAGCTTGTGGAGCCCGCTGGACTAATCAAAGAAGGGTCGTTCCATGTTGCTGTCCCTGAA
rJMSF050O05+ GAGCTTGTGGAGCCCGCTGGACTAATCAAAGAAGGGTCGTTCCATGTTGCTGTCCCTGAA
rJMFF004P24+ GAGCTTGTGGAGCCCGCTGGACTAATCAAAGAAGGGTCGTTCCATGTTGCTGTCCCTGAA
rJMSF030N18+ GAGCTTGTGGAGCCCGCTGGACTAATCAAAGAAGGGTCGTTCCATGTTGCTGTCCCTGAA
                      ____________________________________________________________
consensus GAGCTTGTGGAGCCCGCTGGACTAATCAAAGAAGGGTCGTTCCATGTTGCTGTCCCTGAA
 
. : . : . : . : . : . :
rJMSF039B01+ CCAGATCCTGATGATGCTAATATTGCTAAAACCTTGGCATCGGAATTTCAAAGACTCGGG
rJMSF050P14+ CCAGATCCTGATGATGCTAATATTGCTAAAACCTTGGCATCGGAATTTCAAAGACTCGGG
rJMSF050O05+ CCAGATCCTGATGATGCTAATATTGCTAAAACCTTGGCATCGGAATTTCAAAGACTCGGG
rJMFF004P24+ CCAGATCCTGATGATGCTAATATTGCTAAAACCTTGGCATCGGAATTTCAAAGACTCGGG
rJMSF030N18+ CCAGATCCTGATGATGCTAATATTGCTAAAACCTTGGCATCGGAATTTCAAAGACTCGGG
                      ____________________________________________________________
consensus CCAGATCCTGATGATGCTAATATTGCTAAAACCTTGGCATCGGAATTTCAAAGACTCGGG
 
. : . : . : . : . : . :
rJMSF039B01+ GAGAATGGCATTTCCAAGTCGTTCCGTGAAGTTAAGATCAATGGTGAGGTCAAAGCTGAA
rJMSF050P14+ GAGAATGGCATTTCCAAGTCGTTCCGTGAAGTTAAGATCAATGGTGAGGTCAAAGCTGAA
rJMSF050O05+ GAGAATGGCATTTCCAAGTCGTTCCGTGAAGTTAAGATCAATGGTGAGGTCAAAGCTGAA
rJMFF004P24+ GAGAATGGCATTTCCAAGTCGTTCCGTGAAGTTAAGATCAATGGTGAGGTCAAAGCTGAA
rJMSF030N18+ GAGAATGGCATTTCCAAGTCGTTCCGTGAAGTTAAGATCAATGGTGAGGTCAAAGCTGAA
                      ____________________________________________________________
consensus GAGAATGGCATTTCCAAGTCGTTCCGTGAAGTTAAGATCAATGGTGAGGTCAAAGCTGAA
 
. : . : . : . : . : . :
rJMSF039B01+ TAAATGAGTGCATATCGTTGACATACAGTTTGGGTGACTGTTCATCGTAATCCTGGGTAT
rJMSF050P14+ TAAATGAGTGCATATCGTTGACATACAGTTTGGGTGACTGTTCATCGTAATCCTGGGTAT
rJMSF050O05+ TAAATGAGTGCATATCGTTGACATACAGTTTGGGTGACTGTTCATCGTAATCCTGGGTAT
rJMFF004P24+ TAAATGAGTGCATATCGTTGACATACAGTTTGGGTGACTGTTCATCGTAATCCTGGGTAT
rJMSF030N18+ TAAATGAGTGCATATCGTTGACATACAGTTTGGGTGACTGTTCATCGTAATCCTGGGTAT
                      ____________________________________________________________
consensus TAAATGAGTGCATATCGTTGACATACAGTTTGGGTGACTGTTCATCGTAATCCTGGGTAT
 
. : . : . : . : . : . :
rJMSF039B01+ TAGATGAGAGGATTTCACTAAGCTTAGATATGTTGTAGTATTGTATTACTGGCTTGCATC
rJMSF050P14+ TAGATGAGAGGATTTCACTAAGCTTAGATATGTTGTAGTATTGTATTACTGGCTTGCATC
rJMSF050O05+ TAGATGAGAGGATTTCACTAAGCTTAGATATGTTGTAGTATTGTATTACTGGCTTGCATC
rJMFF004P24+ TAGATGAGAGGATTTCACTAAGCTTAGATATGTTGTAGTATTGTATTACTGGCTTGCATC
rJMSF030N18+ TAGATGAGAGGATTTCACTAAGCTTAGATATGTTGTAGTATTGTATTACTGGCTTGCATC
                      ____________________________________________________________
consensus TAGATGAGAGGATTTCACTAAGCTTAGATATGTTGTAGTATTGTATTACTGGCTTGCATC
 
. : . : . : . : . : . :
rJMSF039B01+ ATCTCGATGCTGGAGTTAGGACGAGGCAATGTTATAACT
rJMSF050P14+ ATCTCGATGCTGGAGTTAGGACGA-GCAATGTTATAACTTGAATTTAGAGTGGGATAGTC
rJMSF050O05+ ATCTCGATGCTGGAGTTAGGACGA-GCAATGTTATAACTTGAATTTAGAGTGGGATAGTC
rJMFF004P24+ ATCTCGATGCTGGAGTTAGGACGA-GCAATGTTATAACTTGAATTTAGAGTGGGATAGTC
rJMSF030N18+ ATCTCGATGCTGGAGTTAGGACGA-GCAATGTTATAACTTGAATTTAGAGTGGGATAGTC
                      ____________________________________________________________
consensus ATCTCGATGCTGGAGTTAGGACGA-GCAATGTTATAACTTGAATTTAGAGTGGGATAGTC
 
. : . : . : . : . : . :
rJMSF050P14+ GATCATGTTGTTTGAATATGGTATGGATGATGGTCATATTTTGCCTCTCTTCTG
rJMSF050O05+ GATCATGTTGTTTGAATATGGTATGGATGATGGTCATATTTTGCCTCTCTTCTGTTGTGA
rJMFF004P24+ GATCATGTTGTTTGAATATGGTATGGATGATGGTCATATTTTGCCTCTCTTCTGTTGTGA
rJMSF030N18+ GATCATGTTGTTTGAATATGGTATGGATGATGGTCATATTTTGCCTCTCTTCTGTTGTGA
                      ____________________________________________________________
consensus GATCATGTTGTTTGAATATGGTATGGATGATGGTCATATTTTGCCTCTCTTCTGTTGTGA
 
. : . : . : . : . : . :
rJMSF050O05+ AATAGCCTATACTGCTCATTTGTTGACCATT
rJMFF004P24+ AATAGCCTATACTGCTCATTTGTTGACCATTTGTAATTGTTGG
rJMSF030N18+ AATAGCCTATACTGCTCATTTGTTGACCATTTGTAATTGTTGGTTTTGTTGATTAATGTT
                      ____________________________________________________________
consensus AATAGCCTATACTGCTCATTTGTTGACCATTTGTAATTGTTGGTTTTGTTGATTAATGTT