Previous Contig 012744:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030N17Sequence616012744 (2)gb:OSJN00023_16934785e-77Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0016O02, complete seque718012744 (2)gb:AB158759_15284204e-66Oryza sativa (japonica cultivar-group) mRNA for P450, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030N17- GAAGAAGGAGAAGGCATCTTGGAGATCA
                      ____________________________________________________________
consensus GAAGAAGGAGAAGGCATCTTGGAGATCA
 
. : . : . : . : . : . :
JMSF030N17- TAACAGTAAAAAGAATGATTTTCTTGAGATACTGTTATATGTGGATACCTTATCTGAAGA
                      ____________________________________________________________
consensus TAACAGTAAAAAGAATGATTTTCTTGAGATACTGTTATATGTGGATACCTTATCTGAAGA
 
. : . : . : . : . : . :
JMSF030N17- TGAAAAGATTAGTTTTGTTCTAGATTCTCTCCTAGGTGGTTATGAGACCACCTCGCTCTT
                      ____________________________________________________________
consensus TGAAAAGATTAGTTTTGTTCTAGATTCTCTCCTAGGTGGTTATGAGACCACCTCGCTCTT
 
. : . : . : . : . : . :
JMSF030N17- GCTGTCCATGGTTGTTTATTTTCTTGGTCAATCCACCTCTGCCCTTGAACAATTAAAGCT
rJMSF030N17+ CTGTCCATGGTTG-TTATTTTCTTGGTCAATCCACCTCTGCCCTTGAACAATTAAAGCT
                      ____________________________________________________________
consensus GCTGTCCATGGTTGTTTATTTTCTTGGTCAATCCACCTCTGCCCTTGAACAATTAAAGCT
 
. : . : . : . : . : . :
JMSF030N17- TGAACATCAAAGCATAAGGAGCATGAAGAAAAAGGGAGAGTTCTTGAACTGGGAAGACTA
rJMSF030N17+ TGAACATCAAAGCATAAGGAGCATGAAGAAAAAGGGAGAGTTCTTGAACTGGGAAGACTA
                      ____________________________________________________________
consensus TGAACATCAAAGCATAAGGAGCATGAAGAAAAAGGGAGAGTTCTTGAACTGGGAAGACTA
 
. : . : . : . : . : . :
JMSF030N17- TAAAAAAATGGATTTTAGTCAAAAGGTCATGAATGAAGCTCTTAGATATGGAAATGTTGT
rJMSF030N17+ TAAAAAAATGGATTTTAGTCAAAAGGTCATGAATGAAGCTCTTAGATATGGAAATGTTGT
                      ____________________________________________________________
consensus TAAAAAAATGGATTTTAGTCAAAAGGTCATGAATGAAGCTCTTAGATATGGAAATGTTGT
 
. : . : . : . : . : . :
JMSF030N17- TAAATTTGTGCACCGAAAAGCACTCAAAGATGTCAAATTTAGAGATTACATTATTCCATC
rJMSF030N17+ TAAATTTGTGCACCGAAAAGCACTCAAAGATGTCAAATTTAGAGATTACATTATTCCATC
                      ____________________________________________________________
consensus TAAATTTGTGCACCGAAAAGCACTCAAAGATGTCAAATTTAGAGATTACATTATTCCATC
 
. : . : . : . : . : . :
JMSF030N17- TGGTTGGAAGGTCCTACCAGTTTTTAGTGCAGTTCACTTGGATCAAAACCTCCATGCCAA
rJMSF030N17+ TGGTTGGAAGGTCCTACCAGTTTTTAGTGCAGTTCACTTGGATCAAAACCTCCATGCCAA
                      ____________________________________________________________
consensus TGGTTGGAAGGTCCTACCAGTTTTTAGTGCAGTTCACTTGGATCAAAACCTCCATGCCAA
 
. : . : . : . : . : . :
JMSF030N17- TGCTCTGCAATTTAATCCTTGGAGATGGGAGAGTGATGATCAAACATGCAAGAAATTCAC
rJMSF030N17+ TGCTCTGCAATTTAATCCTTGGAGATGGGAGAGTGATGATCAAACATGCAAGAAATTCAC
                      ____________________________________________________________
consensus TGCTCTGCAATTTAATCCTTGGAGATGGGAGAGTGATGATCAAACATGCAAGAAATTCAC
 
. : . : . : . : . : . :
JMSF030N17- ACCTTTTGGTGGAGGGTCTAGGTCCTGCCCTGGCTCTGAACTTGCAAAGGTTGAGGTTGC
rJMSF030N17+ ACCTTTTGGTGGAGGGTCTAGGTCCTGCCCTGGCTCTGAACTTGCAAAGGTTGAGGTTGC
                      ____________________________________________________________
consensus ACCTTTTGGTGGAGGGTCTAGGTCCTGCCCTGGCTCTGAACTTGCAAAGGTTGAGGTTGC
 
. : . : . : . : . : . :
JMSF030N17- ATTTTTCCTGCACCACCTTATACAAAACTACAGGTGGAAAGTGGAAGA
rJMSF030N17+ ATTTTTCCTGCACCACCTTATACAAAACTACAGGTGGAAAGTGGAAGAAGGTGAAGAAGC
                      ____________________________________________________________
consensus ATTTTTCCTGCACCACCTTATACAAAACTACAGGTGGAAAGTGGAAGAAGGTGAAGAAGC
 
. : . : . : . : . : . :
rJMSF030N17+ CATGGCATATCCATATGTAGAGTTCCATAAAGGACTGGCAATAAAGTTGCAGCCATTAAA
                      ____________________________________________________________
consensus CATGGCATATCCATATGTAGAGTTCCATAAAGGACTGGCAATAAAGTTGCAGCCATTAAA
 
. : . : . : . : . : . :
rJMSF030N17+ CCACCAGTTTGGTTCTGGGTGAAGTGATCAGAGTGTGATGAGATGACGGCTAAAGAAGGC
                      ____________________________________________________________
consensus CCACCAGTTTGGTTCTGGGTGAAGTGATCAGAGTGTGATGAGATGACGGCTAAAGAAGGC
 
. : . : . : . : . : . :
rJMSF030N17+ AGGCAAGATTGGTGGAGCATTTTCTATTTTTGTAATTTAATTATTTCGGAGATATATATA
                      ____________________________________________________________
consensus AGGCAAGATTGGTGGAGCATTTTCTATTTTTGTAATTTAATTATTTCGGAGATATATATA
 
. : . : . : . : . : . :
rJMSF030N17+ AGGTCTCCCTTTTTAATTCCCTGTTGCACAGGAATTTTGTACTAATTCTTGCATTTGCTT
                      ____________________________________________________________
consensus AGGTCTCCCTTTTTAATTCCCTGTTGCACAGGAATTTTGTACTAATTCTTGCATTTGCTT