Previous Contig 012733:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025O17Sequence617003456 (4)790012733 (2)sp|Q9LD37|CG20_ARATH4e-81Probable cyclic nucleotide-gated ion channel 20, chloroplast precursor (Cyclic n
JMSF030K03Sequence652019627sp|Q9LD37|CG20_ARATH3e-22Probable cyclic nucleotide-gated ion channel 20, chloroplast precursor (Cyclic n726012733 (2)sp|Q9LD37|CG20_ARATH5e-64Probable cyclic nucleotide-gated ion channel 20, chloroplast precursor (Cyclic n

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025O17+ CGCTTGCCAGAGGGATTAAGAAGGC
                      ____________________________________________________________
consensus CGCTTGCCAGAGGGATTAAGAAGGC
 
. : . : . : . : . : . :
rJMFF025O17+ GAGTACGACTAGCTGAACGCTATACATGGGCAGCTACCAGAGGGGTGAATGAAGAAATGT
                      ____________________________________________________________
consensus GAGTACGACTAGCTGAACGCTATACATGGGCAGCTACCAGAGGGGTGAATGAAGAAATGT
 
. : . : . : . : . : . :
rJMFF025O17+ TGTTGGAGAACCTACCTGAAGACGTACAAAGAGATATAAGAAGGCATCTTTTTAAATTTA
rJMSF030K03+ TTAAATTTG
                      ____________________________________________________________
consensus TGTTGGAGAACCTACCTGAAGACGTACAAAGAGATATAAGAAGGCATCTTTTTAAATTTG
 
. : . : . : . : . : . :
rJMFF025O17+ TCAAGAAGGTCCGCATTTTTGCACTTGTAGATGAGCTAGTCTTAGATGCTATTTGTGAAA
rJMSF030K03+ TCAAGAAGGTCCACATTTTTGCACTGCTAGATGAGCCAATCTTGGATGCCATTTGTGAAA
                      ____________________________________________________________
consensus TCAAGAAGGTCCGCATTTTTGCACTTGTAGATGAGCTAGTCTTGGATGCTATTTGTGAAA
 
. : . : . : . : . : . :
rJMFF025O17+ GGTTAAGACTAACAACGTATATAGAAGGAAGCAAAGTTTTCTACCGAGGTGGTCTTATTG
rJMSF030K03+ GATTAAGACAAAAGACATATATAAAAGGAAGCAGGGTTTTGTACCAAGGTGGTCTCATCG
                      ____________________________________________________________
consensus GGTTAAGACTAACGACGTATATAGAAGGAAGCAGGGTTTTGTACCGAGGTGGTCTTATTG
 
. : . : . : . : . : . :
rJMFF025O17+ ACAAGATGGTTTTCATCATCCGGGGAAAGATGGAAAGCACAGGAGAAGATGGAAACGTGG
rJMSF030K03+ ACAAGATGGTTTTCATCATCCGGGGAAACATGGAAAGCATCGGAGAGGATGGAAATGCGA
                      ____________________________________________________________
consensus ACAAGATGGTTTTCATCATCCGGGGAAAGATGGAAAGCATCGGAGAGGATGGAAATGTGG
 
. : . : . : . : . : . :
rJMFF025O17+ CCATGTTGTCTGAAGGGGATGCTTGTGGGGAAGAGCTCCTCACATGGTGCCTAGAACATT
rJMSF030K03+ GCATATTGTCTGAAGGGGATGCTTGTGGGGAAGAACTCCTCACATGGTGCCTAGAGCATT
                      ____________________________________________________________
consensus GCATGTTGTCTGAAGGGGATGCTTGTGGGGAAGAGCTCCTCACATGGTGCCTAGAGCATT
 
. : . : . : . : . : . :
rJMFF025O17+ CCTCTTCTGTAAATAAAGATGGAATAAAGATGAAGATTCCAGGTGGACACAGGCTACTTA
rJMSF030K03+ ---CTTCCGTAAATAAAGATGGAAGAAAGATCAGAATTCCA---GGACCCAGGCTGCTTA
                      ____________________________________________________________
consensus CCTCTTCTGTAAATAAAGATGGAATAAAGATGAGGATTCCAGGTGGACCCAGGCTGCTTA
 
. : . : . : . : . : . :
rJMFF025O17+ GTAACAGGATTGTAAAGTGCCTAAGCAATGTTGAAGCATTTATATTGCGAGAAGCAGATC
rJMSF030K03+ GTAATCGGGGCGTCGAGTGCCTAACTAACGTTGAAGCATTTATATTGCGGGCAGCAGACA
                      ____________________________________________________________
consensus GTAATCGGGTTGTCGAGTGCCTAAGTAATGTTGAAGCATTTATATTGCGGGCAGCAGATC
 
. : . : . : . : . : . :
rJMFF025O17+ TTGAAGAAGTCATTTCTCTGTTTGCAAGATTCTTGAGGAACACCCGTGTTCAGGGTGCCA
rJMSF030K03+ TTGAAGAAGTCACTTCTCTGTTTGCAAGATTCTTGAGGAGCCCGCGGGTTCAGGGTGCCA
                      ____________________________________________________________
consensus TTGAAGAAGTCATTTCTCTGTTTGCAAGATTCTTGAGGAGCCCGCGTGTTCAGGGTGCCA
 
. : . : . : . : . : . :
rJMFF025O17+ TAAGGTATGAATCTCCTTATTGGCGAGCCCTGGCAGCACGTTGCATTCAAGTTGCATGGA
rJMSF030K03+ TAAGGTATGCATCTCCTTATTGGAGAGGTCGGGCAGCAAGGTGCATTCAAGTTGCATGGA
                      ____________________________________________________________
consensus TAAGGTATGCATCTCCTTATTGGCGAGGTCTGGCAGCACGTTGCATTCAAGTTGCATGGA
 
. : . : . : . : . : . :
rJMFF025O17+ GATATAGAAAGAAGCGTCTAAGTCGTGCAGA
rJMSF030K03+ GATATAGGAAGAAGCGTCAAAGTCGTGCAGATGGCGCCAGCCCACAACATTCTCTTAGAG
                      ____________________________________________________________
consensus GATATAGGAAGAAGCGTCTAAGTCGTGCAGATGGCGCCAGCCCACAACATTCTCTTAGAG
 
. : . : . : . : . : . :
rJMSF030K03+ ACGAAAATCTGTTCATCAACTTGTAGATTGTAAATGTTTTTGTTGTGTACGTAACATTAT
                      ____________________________________________________________
consensus ACGAAAATCTGTTCATCAACTTGTAGATTGTAAATGTTTTTGTTGTGTACGTAACATTAT
 
. : . : . : . : . : . :
rJMSF030K03+ AGTTTGTAAAAATTTTGTCTGTCAGCTTCTAGTTTGTCTCCCACAGGCATTATATTTGTA
                      ____________________________________________________________
consensus AGTTTGTAAAAATTTTGTCTGTCAGCTTCTAGTTTGTCTCCCACAGGCATTATATTTGTA
 
. : . : . : . : . : . :
rJMSF030K03+ GTTTGTGTCTCCCATAGGCATTATATTTGTCATCCAATACGGACACAATTAATGTGCATA
                      ____________________________________________________________
consensus GTTTGTGTCTCCCATAGGCATTATATTTGTCATCCAATACGGACACAATTAATGTGCATA