Previous Contig 012723:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002C24Sequence419001807 (126)gb:AY224544_15907413e-70Oryza sativa (japonica cultivar-group) isolate 23829 wheat adenosylhomocysteinas703012723 (3)gb:AP001313_18211745e-51Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:T5M7.
JMSF030H20Sequence591012723 (3)gb:AB006708_15100543e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:BT010427_1640696012723 (3)gb:AP004161_18384078e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030H20- G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMSF030H20- ATACCGTTAGTTAGGAGAGTCTGATAACCTTCTCCTTCTCTCTCTCTCTCTCTCATCATT
                      ____________________________________________________________
consensus ATACCGTTAGTTAGGAGAGTCTGATAACCTTCTCCTTCTCTCTCTCTCTCTCTCATCATT
 
. : . : . : . : . : . :
JMSF030H20- CTCCGGCGACGGCGACCAGTACAGGATGAAGACAATCATGGCGAGGAACCCAGGCGATTC
                      ____________________________________________________________
consensus CTCCGGCGACGGCGACCAGTACAGGATGAAGACAATCATGGCGAGGAACCCAGGCGATTC
 
. : . : . : . : . : . :
JMSF030H20- CTTCTCCTTCTCCAGAAGATACTTCCACTCGAAGATCAAGAAGCTCGAGGAGGAGGAAGA
rJMSF002C24+ CTCCAGAAGATACTTCCACTCGAAGATCAAGAAGCTCGAGGAGGAGGAAGA
                      ____________________________________________________________
consensus CTTCTCCTTCTCCAGAAGATACTTCCACTCGAAGATCAAGAAGCTCGAGGAGGAGGAAGA
 
. : . : . : . : . : . :
JMSF030H20- CGACGACCGCGAGGAGATTCTAGAGTGGAAGCTCCCGGAGGAGCTCGATCTCGCAGCGCC
rJMSF002C24+ CGACGACCGCGAGGAGATTCTAGAGTGGAAGCTCCCGGAGGAGCTCGATCTCGCAGCGCC
                      ____________________________________________________________
consensus CGACGACCGCGAGGAGATTCTAGAGTGGAAGCTCCCGGAGGAGCTCGATCTCGCAGCGCC
 
. : . : . : . : . : . :
JMSF030H20- GCCGCCGCGGCGTAAGACGGCGGTTTCAAAGCTCCGGTCGGCTCTCACGTTCGGCATCAA
rJMSF002C24+ GCCGCCGCGGCGTAAGACGGCGGTTTCAAAGCTCCGGTCGGCTCTCACGTTCGGCATCAA
                      ____________________________________________________________
consensus GCCGCCGCGGCGTAAGACGGCGGTTTCAAAGCTCCGGTCGGCTCTCACGTTCGGCATCAA
 
. : . : . : . : . : . :
JMSF030H20- GAGCCCCCTCGGCGCCAGAGTGGTCGGAACCCTGTTCGGGTTCCGCCGCGGGCGCGTGCA
rJMSF002C24+ GAGCCCCCTCGGCGCCAGAGTGGTCGGAACCCTGTTCGGGTTCCGCCGCGGGCGCGTGCA
                      ____________________________________________________________
consensus GAGCCCCCTCGGCGCCAGAGTGGTCGGAACCCTGTTCGGGTTCCGCCGCGGGCGCGTGCA
 
. : . : . : . : . : . :
JMSF030H20- TTTCGCCTTCCAGGAAGACCCGCGCCTGGGCCCGGCCTTCCTGGTGGAGCTCGCCATGCC
rJMSF002C24+ TTTCGCCTTCCAGGAAGACCCGCGCCTGGGCCCGGCCTTCCTGGTGGAGCTCGCCATGCC
                      ____________________________________________________________
consensus TTTCGCCTTCCAGGAAGACCCGCGCCTGGGCCCGGCCTTCCTGGTGGAGCTCGCCATGCC
 
. : . : . : . : . : . :
JMSF030H20- CACCGGCGTTCTGGTCCGGGAAATGGCTTCCGGGCCGGTCCGAATCGCTTTGGAGTGCGA
rJMSF002C24+ CACCGGCGTTCTGGTCCGGGAAATGGCTTCCGGGCCGGTCCGAATCGCTTTGGAGTGCGA
rJMSF030H20+ GGCTTCCGGGCCGGTCCGAATCGCTTTGGAGTGCGA
                      ____________________________________________________________
consensus CACCGGCGTTCTGGTCCGGGAAATGGCTTCCGGGCCGGTCCGAATCGCTTTGGAGTGCGA
 
. : . : . : . : . : . :
JMSF030H20- GGGGAACACAAACACATGGGAGAAGAATAAGAAGAAGAAGAAGGCGAAGCTTCTAGAAGA
rJMSF002C24+ GGGGAACACAAACACATGGGAGAAGAATAAGAAGAAGAAGAAGGCGAAGCTTCTAGAAGA
rJMSF030H20+ GGGGAACACAAACACATGGGAGAAGAATAAGAAGAAGAAGAAGGCGAAGCTTCTAGAAGA
                      ____________________________________________________________
consensus GGGGAACACAAACACATGGGAGAAGAATAAGAAGAAGAAGAAGGCGAAGCTTCTAGAAGA
 
. : . : . : . : . : . :
JMSF030H20- GCCCGCTTGGCGGACGTACTGTAACGGGCGGAAATGCGGGTTCGCGGCGA
rJMSF002C24+ GCCCGCTTGGCGGACGTACTGTAACGGGCGGAAATGCGGGTTCGCGGCGAGGAGAGAATG
rJMSF030H20+ GCCCGCTTGGCGGACGTACTGTAACGGGCGGAAATGCGGGTTCGCGGCGAGGAGAGAATG
                      ____________________________________________________________
consensus GCCCGCTTGGCGGACGTACTGTAACGGGCGGAAATGCGGGTTCGCGGCGAGGAGAGAATG
 
. : . : . : . : . : . :
rJMSF002C24+ CGGGCCGGACGATTGGCGGGTGTTGAACTCCATCGGCCCGATCACAATGGGCGCCGGAGT
rJMSF030H20+ CGGGCCGGACGATTGGCGGGTGTTGAACTCCATCGGCCCGATCACAATGGGCGCCGGAGT
                      ____________________________________________________________
consensus CGGGCCGGACGATTGGCGGGTGTTGAACTCCATCGGCCCGATCACAATGGGCGCCGGAGT
 
. : . : . : . : . : . :
rJMSF002C24+ TTTGCCCGGAAAGGAGGACGACGGGATCGGGCC-GACGGCGAGCTAATGTACATGAGGGC
rJMSF030H20+ TTTGCCCGGAAAGGAGGACGACGGGATCGGGCCGGACGGCGAGCTAATGTACATGAGGGC
                      ____________________________________________________________
consensus TTTGCCCGGAAAGGAGGACGACGGGATCGGGCCGGACGGCGAGCTAATGTACATGAGGGC
 
. : . : . : . : . : . :
rJMSF002C24+ AAAGTATGAACGAGTTGTGGGGTCCAGAGACTCTGAAGCTTTCTACATGATGAGCCCTGA
rJMSF030H20+ AAAGTATGAACGAGTTGTGGGGTCCAGAGACTCTGAAGCTTTCTACATGATGAGCCCTGA
                      ____________________________________________________________
consensus AAAGTATGAACGAGTTGTGGGGTCCAGAGACTCTGAAGCTTTCTACATGATGAGCCCTGA
 
. : . : . : . : . : . :
rJMSF002C24+ TGGCCATGGCGGTCCTGAGCTTAGCATCTATTTACTAAGAGCTTAATCAATTC
rJMSF030H20+ TGGCCATGGCGGTCCTGAGCTTAGCATCTATTTACTAAGAGCTTAATCAATTCTTAGATC
                      ____________________________________________________________
consensus TGGCCATGGCGGTCCTGAGCTTAGCATCTATTTACTAAGAGCTTAATCAATTCTTAGATC
 
. : . : . : . : . : . :
rJMSF030H20+ ATTATAATTATATATCAATCTCTGTTTTAATCACTATTTTGTTATGCTTTAAGTTCATAA
                      ____________________________________________________________
consensus ATTATAATTATATATCAATCTCTGTTTTAATCACTATTTTGTTATGCTTTAAGTTCATAA
 
. : . : . : . : . : . :
rJMSF030H20+ ACAAATTTCTAAAACAAAAAATTCTATAAAACATAAGAGTAAGAATTAATGTTGATTATT
                      ____________________________________________________________
consensus ACAAATTTCTAAAACAAAAAATTCTATAAAACATAAGAGTAAGAATTAATGTTGATTATT
 
. : . : . : . : . : . :
rJMSF030H20+ ATATATAACTTATAAGCAGAAATATATGATTATAGTTGTTTCAAGTATCTTATCTTTAGA
                      ____________________________________________________________
consensus ATATATAACTTATAAGCAGAAATATATGATTATAGTTGTTTCAAGTATCTTATCTTTAGA
 
. : . : . : . : . : . :
rJMSF030H20+ TGGCATGTAGTGATCTCTCCTCTGTGTAGTGATCTCTCCTATGTGGGAGATTGAGCCTCA
                      ____________________________________________________________
consensus TGGCATGTAGTGATCTCTCCTCTGTGTAGTGATCTCTCCTATGTGGGAGATTGAGCCTCA
 
. : . : . : . : . : . :
rJMSF030H20+ ATGAAGGCGTTATTGACTCTTTGTACTTCATTAAATTGAGAAAGTATGTTGAACAGATAC
                      ____________________________________________________________
consensus ATGAAGGCGTTATTGACTCTTTGTACTTCATTAAATTGAGAAAGTATGTTGAACAGATAC