Previous Contig 012722:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030G15Sequence502012722 (4)sp|Q9M9G7|CAPB_ARATH6e-62Probable F-actin capping protein beta subunit (CapZ-beta).>pir|D96740|D96740 hyp111012722 (4)gb:AK118228_18162168e-09Arabidopsis thaliana mRNA for unknown protein, complete cds, clone: RAFL19-54-E1
JMSF030H15Sequence668012722 (4)sp|Q9M9G7|CAPB_ARATH5e-89Probable F-actin capping protein beta subunit (CapZ-beta).>pir|D96740|D96740 hyp751012722 (4)sp|Q9M9G7|CAPB_ARATH2e-71Probable F-actin capping protein beta subunit (CapZ-beta).>pir|D96740|D96740 hyp

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030G15- GGAGAGTGAAAAAAGAAGAATGGAGGCAGCGCTGGNATTGATGANAAGAATGC
JMSF030H15- GGAGAGTGAAAAAAGAAGAATGGAGGCAGCGCTGGGATTGATGAGAAGAATGC
                      ____________________________________________________________
consensus GGAGAGTGAAAAAAGAAGAATGGAGGCAGCGCTGGGATTGATGAGAAGAATGC
 
. : . : . : . : . : . :
JMSF030G15- CGCCNAAGCGCATGGAGACGGCTCTCTCTGCTTTGCTCAGCCTCTTGCCGGACCACTCAT
JMSF030H15- CGCCTAAGCGCATGGAGACGGCTCTCTCTGCTTTGCTCAGCCTCTTGCCGGACCACTCAT
                      ____________________________________________________________
consensus CGCCTAAGCGCATGGAGACGGCTCTCTCTGCTTTGCTCAGCCTCTTGCCGGACCACTCAT
 
. : . : . : . : . : . :
JMSF030G15- CANATCTCCTCTCTCANGTCGATCAGCCTCTCCAGGTTATGGTTGATATGGAAACCGGAA
JMSF030H15- CAGATCTCCTCTCTCAGGTCGATCAGCCTCTCCAGGTTATGGTTGATATGGAAACCGGAA
                      ____________________________________________________________
consensus CAGATCTCCTCTCTCAGGTCGATCAGCCTCTCCAGGTTATGGTTGATATGGAAACCGGAA
 
. : . : . : . : . : . :
JMSF030G15- AGGAATTCATATTGTGTGAATATAACAGAGATGCTGACTCCTATAGGTCGCCTTTGTCAN
JMSF030H15- AGGAATTCATATTGTGTGAATATAACAGAGATGCTGACTCCTATAGGTCGCCTTTGTCAA
                      ____________________________________________________________
consensus AGGAATTCATATTGTGTGAATATAACAGAGATGCTGACTCCTATAGGTCGCCTTTGTCAA
 
. : . : . : . : . : . :
JMSF030G15- ATACGTATCATCCACCACTAGAAGATGGAGCTTATCCATCTGCANAGTTGAGGANACTTG
JMSF030H15- ATACGTATCATCCACCACTAGAAGATGGAGCTTATCCATCTGCAGAGTTGAGGAAACTTG
                      ____________________________________________________________
consensus ATACGTATCATCCACCACTAGAAGATGGAGCTTATCCATCTGCAGAGTTGAGGAAACTTG
 
. : . : . : . : . : . :
JMSF030G15- AAATTGAAGCAAATGAAGTCTTTGCTGTTTATCGTGACCAGTATTATGAAGGTGGCATTT
JMSF030H15- AAATTGAAGCAAATGAAGTCTTTGCTGTTTATCGTGACCAGTATTATGAAGGTGGCATTT
rJMSF030H15+ TATCGTGACCAGTATTATGAAGGTGGCATTT
                      ____________________________________________________________
consensus AAATTGAAGCAAATGAAGTCTTTGCTGTTTATCGTGACCAGTATTATGAAGGTGGCATTT
 
. : . : . : . : . : . :
JMSF030G15- CATCAGTTTACATGTGGGAAGATGAACATGAAGGCTTCATTGCCTGCTTCTTAATAAAGA
JMSF030H15- CATCAGTTTACATGTGGGAAGATGAACATGAAGGCTTCATTGCCTGCTTCTTAATAAAGA
rJMSF030H15+ CATCAGTTTACATGTGGGAAGATGAACATGAAGGCTTCATTGCCTGCTTCTTAATAAAGA
                      ____________________________________________________________
consensus CATCAGTTTACATGTGGGAAGATGAACATGAAGGCTTCATTGCCTGCTTCTTAATAAAGA
 
. : . : . : . : . : . :
JMSF030G15- AAGATGGCTCAAAATCTGGACATGGTAGAAGGGGATATCTGCAGGAAGGAGCCTGGGATG
JMSF030H15- AAGATGGCTCAAAATCTGGACATGGTAGAAGGGGATATCTGCAGGAAGGAGCCTGGGATG
rJMSF030H15+ AAGATGGCTCAAAATCTGGACATGGTAGAAGGGGATATCTGCAGGAAGGAGCCTGGGATG
                      ____________________________________________________________
consensus AAGATGGCTCAAAATCTGGACATGGTAGAAGGGGATATCTGCAGGAAGGAGCCTGGGATG
 
. : . : . : . : . : . :
JMSF030G15- CTATACATGTTATCCAGGTTGGTCCAGAG
JMSF030H15- CTATACATGTTATCCAGGTTGGTCCAGAGGAAGAAGGGACAGCACACTACTGCCTGACTA
rJMSF030H15+ CTATACATGTTATCCAGGTTGGTCCAGAGGAAGAAGGGACAGCACACTACTGCCTGACTA
                      ____________________________________________________________
consensus CTATACATGTTATCCAGGTTGGTCCAGAGGAAGAAGGGACAGCACACTACTGCCTGACTA
 
. : . : . : . : . : . :
JMSF030H15- GTACTGTGATGCTATCTTTGACCACAAATAATGAGTCCTCAGGCACCTTCAATTTGACAG
rJMSF030H15+ GTACTGTGATGCTATCTTTGACCACAAATAATGAGTCCTCAGGCACCTTCAATTTGACAG
                      ____________________________________________________________
consensus GTACTGTGATGCTATCTTTGACCACAAATAATGAGTCCTCAGGCACCTTCAATTTGACAG
 
. : . : . : . : . : . :
JMSF030H15- GATCGATAAGAAGACAGATGAATATGCAATTCCCTCTCTCGGAGGGTCATTTATGCACCA
rJMSF030H15+ GATCGATAAGAAGACAGATGAATATGCAATTCCCTCTCTCGGAGGGTCATTTATGCAACA
                      ____________________________________________________________
consensus GATCGATAAGAAGACAGATGAATATGCAATTCCCTCTCTCGGAGGGTCATTTATGCACCA
 
. : . : . : . : . : . :
JMSF030H15- TGGGAAGGATGATTG
rJMSF030G15+ TTGAGGAAANGGAGGGCAAACTTAGGAACTCCCTTGATCAGGTTTATT
rJMSF030H15+ TGGGAAGGATGATTGAGGAAATGGAGGGCAAACTTAGGAACTCCCTTGATCAGGTTTATT
                      ____________________________________________________________
consensus TGGGAAGGATGATTGAGGAAATGGAGGGCAAACTTAGGAACTCCCTTGATCAGGTTTATT
 
. : . : . : . : . : . :
rJMSF030G15+ TNGGAAANACAAAGGAAATGGTCTGTATTTTACGCCCTCCATNTGAANTGGTGCAAATGA
rJMSF030H15+ TTGGAAAGACAAAGGAAATGGTCTGTATTTTACGCCCTCCATCTGAACTGGTGCAAATGA
                      ____________________________________________________________
consensus TTGGAAAGACAAAGGAAATGGTCTGTATTTTACGCCCTCCATCTGAACTGGTGCAAATGA
 
. : . : . : . : . : . :
rJMSF030G15+ AAC
rJMSF030H15+ AACTGCCTTCGAGCTAAGATAAGATATACATGCCATCTCCATTGATCAGTATTAATAAAA
                      ____________________________________________________________
consensus AACTGCCTTCGAGCTAAGATAAGATATACATGCCATCTCCATTGATCAGTATTAATAAAA
 
. : . : . : . : . : . :
rJMSF030H15+ ATACATTTCCAGATTTGTTTGTTCTGCTATTCATATTGAAGGGGTTGTGCTTCTACAGTG
                      ____________________________________________________________
consensus ATACATTTCCAGATTTGTTTGTTCTGCTATTCATATTGAAGGGGTTGTGCTTCTACAGTG
 
. : . : . : . : . : . :
rJMSF030H15+ AAGGAATTTATTCTTGTTCTTCCAATTATGAATTCAGGCCCGGAGCCACAAGAGTACTTG
                      ____________________________________________________________
consensus AAGGAATTTATTCTTGTTCTTCCAATTATGAATTCAGGCCCGGAGCCACAAGAGTACTTG
 
. : . : . : . : . : . :
rJMSF030H15+ AATCCTATCCGTTTATATGTTGTTGAACAGCAATCTACCTTTTATAATTTGTGAGTTTCT
                      ____________________________________________________________
consensus AATCCTATCCGTTTATATGTTGTTGAACAGCAATCTACCTTTTATAATTTGTGAGTTTCT
 
. : . : . : . : . : . :
rJMSF030H15+ TGGATATGCTAGTTTTTGAGTAAGAATTGAAAGATTGAATATATTGGTTCAAACTTTTGT
                      ____________________________________________________________
consensus TGGATATGCTAGTTTTTGAGTAAGAATTGAAAGATTGAATATATTGGTTCAAACTTTTGT