Previous Contig 012717:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020C09Sequence690012717 (3)gb:AP005919_18601318e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P055807012717 (3)gb:AY087715_15727438e-16Arabidopsis thaliana clone 37878 mRNA, complete sequence.
JMSF030G16Sequence674019616gb:AK119097_18170393e-18Arabidopsis thaliana mRNA for unknown protein, complete cds, clone: RAFL21-45-A1731012717 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020C09- GGGTGGGAGCCTGGGAGGGAATGGTGATTTAGCTTTTGA
                      ____________________________________________________________
consensus GGGTGGGAGCCTGGGAGGGAATGGTGATTTAGCTTTTGA
 
. : . : . : . : . : . :
JMSF020C09- TGAGAATGGGAAGAGGATCATGGGTTTGTACTTTATCCACTCAGGTGGCTCTCTGCTTTG
                      ____________________________________________________________
consensus TGAGAATGGGAAGAGGATCATGGGTTTGTACTTTATCCACTCAGGTGGCTCTCTGCTTTG
 
. : . : . : . : . : . :
JMSF020C09- CTCTTTACCTTGTTCTCAACACGGGACAGTTCCAGAGGTCTCTCTATGGCGACATTGATT
                      ____________________________________________________________
consensus CTCTTTACCTTGTTCTCAACACGGGACAGTTCCAGAGGTCTCTCTATGGCGACATTGATT
 
. : . : . : . : . : . :
JMSF020C09- CTGTGGGCACGTATTTCATCAGTGTTTCAGGGGGTTTTAGGCCTCTTCAAGAACAGATCC
                      ____________________________________________________________
consensus CTGTGGGCACGTATTTCATCAGTGTTTCAGGGGGTTTTAGGCCTCTTCAAGAACAGATCC
 
. : . : . : . : . : . :
JMSF020C09- ATCTTCTCAAGCAGATGGAGATGGTTGCAAAGAAGAACAGAGCTAAATATGTGATCAACA
                      ____________________________________________________________
consensus ATCTTCTCAAGCAGATGGAGATGGTTGCAAAGAAGAACAGAGCTAAATATGTGATCAACA
 
. : . : . : . : . : . :
JMSF020C09- TTAGTGAACTTGGAGAAGGTGATCCGCTCATGCAAAATGCAACCCAGTATTACCAGTCAC
                      ____________________________________________________________
consensus TTAGTGAACTTGGAGAAGGTGATCCGCTCATGCAAAATGCAACCCAGTATTACCAGTCAC
 
. : . : . : . : . : . :
JMSF020C09- TAGAAGTTCCATGGTATACAGTTCAAGCTTTGAAAGGAAAAAGTGGAAATTACTACCTTA
rJMSF020C09+ GGTATACAGNTCCAGCTTTGAAAGGAAAAAGTGGAAATTACTACCTTA
                      ____________________________________________________________
consensus TAGAAGTTCCATGGTATACAGTTCCAGCTTTGAAAGGAAAAAGTGGAAATTACTACCTTA
 
. : . : . : . : . : . :
JMSF020C09- AACACATTGAAGTCACTCATGGACGTACCTTAGACCTTATTGCTATAGATACTACATTAT
rJMSF020C09+ AACACATTGAAGTCACTCATGGACGTACCTTAGACCTTATTGCTATAGATACTACATTAT
                      ____________________________________________________________
consensus AACACATTGAAGTCACTCATGGACGTACCTTAGACCTTATTGCTATAGATACTACATTAT
 
. : . : . : . : . : . :
JMSF020C09- ATCAGGATGTTTCAAGCAGTAAGAAAGATGACCAACTAAAATGGCTCATAAACATACTTG
rJMSF020C09+ ATCAGGATGTTTCAAGCAGTAAGAAAGATGACCAACTAAAATGGCTCATAAACATACTTG
                      ____________________________________________________________
consensus ATCAGGATGTTTCAAGCAGTAAGAAAGATGACCAACTAAAATGGCTCATAAACATACTTG
 
. : . : . : . : . : . :
JMSF020C09- AAGACAGCCAAAGTTATTGGCACATTGTTGTGGGTTTTCATCCATTGGTAGCCTGTGGTG
rJMSF020C09+ AAGACAGCCAAAGTTATTGGCACATTGTTGTGGGTTTTCATCCATTGGTAGCCTGTGGTG
                      ____________________________________________________________
consensus AAGACAGCCAAAGTTATTGGCACATTGTTGTGGGTTTTCATCCATTGGTAGCCTGTGGTG
 
. : . : . : . : . : . :
JMSF020C09- AAGATGTTAAGGACAGGAAAATAGAGAAAAGCTTTGAGCCTTTAATTCATACATTTCTCA
rJMSF020C09+ AAGATGTTAAGGACAGGAAAATAGAGAAAAGCTTTGAGCCTTTAATTCATACATTTCTCA
                      ____________________________________________________________
consensus AAGATGTTAAGGACAGGAAAATAGAGAAAAGCTTTGAGCCTTTAATTCATACATTTCTCA
 
. : . : . : . : . : . :
JMSF020C09- AATATGGAGTGAATGCGTATCTTAGCAGGAAAGCTTGTAATAACTCTGTCG
rJMSF020C09+ AATATGGAGTGAATGCGTATCTTAGCAGGAAAGCTTGTAATAACTCTGTCGATAAAGGTG
rJMSF030G16+ GAATGCGTATCTTAGCAGGAAAGCTTGTAATAACTCTGTCGATAAAGGTG
                      ____________________________________________________________
consensus AATATGGAGTGAATGCGTATCTTAGCAGGAAAGCTTGTAATAACTCTGTCGATAAAGGTG
 
. : . : . : . : . : . :
rJMSF020C09+ GTCTTGATGATTCGAGCAATGTAAGTCGTGTCTATGGACCAGACATGATATCAGCAAATC
rJMSF030G16+ GTCTTGATGATTCGAGCAATGTAAGTCGTGTCTATGGACCAGACATGATATCAGCAAATC
                      ____________________________________________________________
consensus GTCTTGATGATTCGAGCAATGTAAGTCGTGTCTATGGACCAGACATGATATCAGCAAATC
 
. : . : . : . : . : . :
rJMSF020C09+ AAGAATTCCTTTACAGCATGGAAATAACAAATGGTTTCCTTCTCCATAAAGTCACTGATT
rJMSF030G16+ AAGAATTCCTTTACAGCATGGAAATAACAAATGGTTTCCTTCTCCATAAAGTCACTGATT
                      ____________________________________________________________
consensus AAGAATTCCTTTACAGCATGGAAATAACAAATGGTTTCCTTCTCCATAAAGTCACTGATT
 
. : . : . : . : . : . :
rJMSF020C09+ TTGAAATTGTAACCTACTTCGTTACATCTGAAGGGGATTTCGTGCGAAAGGTTGCTCTTC
rJMSF030G16+ TTGAAATTGTAACCTACTTCGTTACATCTGAAGGGGATTTCGTGCGAAAGGTTGCTCTTC
                      ____________________________________________________________
consensus TTGAAATTGTAACCTACTTCGTTACATCTGAAGGGGATTTCGTGCGAAAGGTTGCTCTTC
 
. : . : . : . : . : . :
rJMSF020C09+ AACCACCAAGGGGTAAAGCAAATATGTAGTGTTCATGCTCGTACTGGCTTAGCTCAATAG
rJMSF030G16+ AACCACCAAGGGGTAAAGCAAATATGTAGTGTTCATGCTCGTACTGGCTTAGCTCAATAG
                      ____________________________________________________________
consensus AACCACCAAGGGGTAAAGCAAATATGTAGTGTTCATGCTCGTACTGGCTTAGCTCAATAG
 
. : . : . : . : . : . :
rJMSF020C09+ TCTAGTCGGCAGTATTTGGGAGAAGAGACTAAAGTTCGGCGGCAGTGTGGGGATTATGCC
rJMSF030G16+ TCTAGTCGGCAGTATTTGGGAGAAGAGACTAAAGTTCGGCGGCAGTGTGGGGATTATGCC
                      ____________________________________________________________
consensus TCTAGTCGGCAGTATTTGGGAGAAGAGACTAAAGTTCGGCGGCAGTGTGGGGATTATGCC
 
. : . : . : . : . : . :
rJMSF020C09+ TCCCTTGTGCGCACAGGCATTTGGCCTTGTCTGCTGAGCTATTAAGTCACCGTGATTTAT
rJMSF030G16+ TCCCTTGTGCGCACAGGCATTTGGCCTTGTCTGCTGAGCTATTAAGTCACCGTGATTTAT
                      ____________________________________________________________
consensus TCCCTTGTGCGCACAGGCATTTGGCCTTGTCTGCTGAGCTATTAAGTCACCGTGATTTAT
 
. : . : . : . : . : . :
rJMSF020C09+ ACTCTCAAATGCTCTGTGAAGTGGAGTGTGGAGGGCCTTCTGGGAGAAGGGAATATGTAG
rJMSF030G16+ ACTCTCAAATGCTCTGTGAAGTGGAGTGTGGAGGGCCTTCTGGGAGAAGGGAATATGTAG
                      ____________________________________________________________
consensus ACTCTCAAATGCTCTGTGAAGTGGAGTGTGGAGGGCCTTCTGGGAGAAGGGAATATGTAG
 
. : . : . : . : . : . :
rJMSF020C09+ TGTTCA-TGTTCAGGAAG
rJMSF030G16+ TGTTCATTGTTCAGGAAGTGACTCATTGTCTATCATTCTATTCTTTAATGCTTTGCCATT
                      ____________________________________________________________
consensus TGTTCATTGTTCAGGAAGTGACTCATTGTCTATCATTCTATTCTTTAATGCTTTGCCATT