Previous Contig 012714:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030F23Sequence682003593 (14)gb:AF316412_17855362e-40Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.688012714 (2)gb:AC016661_15381833e-06Arabidopsis thaliana chromosome 3 BAC F11F8 genomic sequence, complete sequence.
JMSF046H06Sequence692003593 (14)gb:AY196151_15889122e-42Solanum tuberosum nematode resistance protein (Gro1-4) gene, Gro1-4-P40 allele, 789012714 (2)gb:AP000492_18202812e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046H06+ ATTGTAGCGC
                      ____________________________________________________________
consensus ATTGTAGCGC
 
. : . : . : . : . : . :
rJMSF046H06+ ATCCACAAGAGCCCAACCAACTTGCATTTGGATTGACAGATGGGTCTATTAAAGTTATTG
                      ____________________________________________________________
consensus ATCCACAAGAGCCCAACCAACTTGCATTTGGATTGACAGATGGGTCTATTAAAGTTATTG
 
. : . : . : . : . : . :
rJMSF046H06+ AACCATTGGAATCCGGAGGGGAGTGGGGAATATCTAGACATAGCCAAGATAAGATCGTGG
rJMSF030F23+ TCTAGACATAGCCAAGATAAGATCGTGG
                      ____________________________________________________________
consensus AACCATTGGAATCCGGAGGGGAGTGGGGAATATCTAGACATAGCCAAGATAAGATCGTGG
 
. : . : . : . : . : . :
rJMSF046H06+ CTGAATAGAGGACTCGAGATAGCTTCGCAATGTCTGGCAATCCGTGTAGATTTGGACCGA
rJMSF030F23+ CTGAATAGAGGACTCGAGATAGCTTCGCAATGTCTGGCAATCCGTGTAGATTTGGACCGA
                      ____________________________________________________________
consensus CTGAATAGAGGACTCGAGATAGCTTCGCAATGTCTGGCAATCCGTGTAGATTTGGACCGA
 
. : . : . : . : . : . :
rJMSF046H06+ TTCTTCTCCTCGCTGTTTGAGCCATGATAAAGCTTCCTTACATGCTAGAGTCTCAGCCAT
rJMSF030F23+ TTCTTCTCCTCGCTGTTTGAGCCATGATAAAGCTTCCTTACATGCTAGAGTCTCAGCCAT
                      ____________________________________________________________
consensus TTCTTCTCCTCGCTGTTTGAGCCATGATAAAGCTTCCTTACATGCTAGAGTCTCAGCCAT
 
. : . : . : . : . : . :
rJMSF046H06+ AAGGGGTGAGAAACAAGTTTGTGGTGGCACGCAGTAGGCCGATACATAAGCTCCAATATG
rJMSF030F23+ AAGGGGTGAGAAACAAGTTTGTGGTGGCACGCAGTAGGCCGATACATAAGCTCCAATATG
                      ____________________________________________________________
consensus AAGGGGTGAGAAACAAGTTTGTGGTGGCACGCAGTAGGCCGATACATAAGCTCCAATATG
 
. : . : . : . : . : . :
rJMSF046H06+ GTCTCGTAATAGAACTCCGGTTGTAGCTTTCATCAAGACGGCATCGTATCCTGCATCTAT
rJMSF030F23+ GTCTCGTAATAGAACTCCGGTTGTAGCTTTCATCAAGACGGCATCGTATCCTGCATCTAT
                      ____________________________________________________________
consensus GTCTCGTAATAGAACTCCGGTTGTAGCTTTCATCAAGACGGCATCGTATCCTGCATCTAT
 
. : . : . : . : . : . :
rJMSF046H06+ AAAGCATTGTTTCGGATATATAGGGCCGTCCGGCAGTAGTGTTGACGTGGGCGGGGCTGG
rJMSF030F23+ AAAGCATTGTTTCGGATATATAGGGCCGTCCGGCAGTAGTGTTGACGTGGGCGGGGCTGG
                      ____________________________________________________________
consensus AAAGCATTGTTTCGGATATATAGGGCCGTCCGGCAGTAGTGTTGACGTGGGCGGGGCTGG
 
. : . : . : . : . : . :
rJMSF046H06+ CACGGCAGTGGTGGCAATAGCGGAGACCGGCAGTATCGCAGTAGGCGCTACTGTTGACGT
rJMSF030F23+ CACGGCAGTGGTGGCAATAGCGGAGACCGGCAGTATCGCAGTAGGCGCTACTGTTGACGT
                      ____________________________________________________________
consensus CACGGCAGTGGTGGCAATAGCGGAGACCGGCAGTATCGCAGTAGGCGCTACTGTTGACGT
 
. : . : . : . : . : . :
rJMSF046H06+ CGGCAGGGCTGGGACGGCGTTGGCGGCAGTAACGGAGGCCGGCAGTATCCCGGCAGCATG
rJMSF030F23+ CGGCAGGGCTGGGACGGCGTTGGCGGCAGTAACGGAGGCCGGCAGTATCCCGGCAGCATG
                      ____________________________________________________________
consensus CGGCAGGGCTGGGACGGCGTTGGCGGCAGTAACGGAGGCCGGCAGTATCCCGGCAGCATG
 
. : . : . : . : . : . :
rJMSF046H06+ GTGTGTGGCAGTGGGCATCTCGGTCGGCAGTGCTACCGGCGGTTGTTTGGCATGTAGTGA
rJMSF030F23+ GTGTGTGGCAGTGGGCATCTCGGTCGGCAGTGCTACCGGCGGTTGTTTGGCATGTAGTGA
                      ____________________________________________________________
consensus GTGTGTGGCAGTGGGCATCTCGGTCGGCAGTGCTACCGGCGGTTGTTTGGCATGTAGTGA
 
. : . : . : . : . : . :
rJMSF046H06+ TTGCCATGTATTCTTCATAGATAGAGTTGCTAATACAACCCTCTTTGGTAATTGTAGGCT
rJMSF030F23+ TTGCCATGTATTCTTCATAGATAGAGTTGCTAATACAACCCTCTTTGGTAATTGTAGGCT
                      ____________________________________________________________
consensus TTGCCATGTATTCTTCATAGATAGAGTTGCTAATACAACCCTCTTTGGTAATTGTAGGCT
 
. : . : . : . : . : . :
rJMSF046H06+ TGCATCCCATACCGCTCCGTTTCGGGCTCTCCAAATATTGTATAAAATTCCAGCTGCAAA
rJMSF030F23+ TGCATCCCATACCGCTCCGTTTCGGGCTCTCCAAATATTGTATAAAATTCCAGCTGCAAA
                      ____________________________________________________________
consensus TGCATCCCATACCGCTCCGTTTCGGGCTCTCCAAATATTGTATAAAATTCCAGCTGCAAA
 
. : . : . : . : . : . :
rJMSF046H06+ CAACATTTCATTAGAGTCTAGAACATTCATAATTGTCCTAAACCATTCATGAAAAATAT
rJMSF030F23+ CAACATTTCATTAGAGTCTAGAACATTCATAATTGTCCTAAACCATTCATGAAAAATATT
                      ____________________________________________________________
consensus CAACATTTCATTAGAGTCTAGAACATTCATAATTGTCCTAAACCATTCATGAAAAATATT