Previous Contig 012711:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030F16Sequence689007561 (5)sp|Q8L4F8|RPO3_NICSY1e-69DNA-directed RNA polymerase 3, chloroplast precursor (EC 2.7.7.6) (T7 bacterioph773012711 (2)gb:NTA416575_16914002e-39Nicotiana tabacum partial nictaRpoT3-tom gene for plastid RNA polymerase, exons
JMSF043I23Sequence730007561 (5)sp|Q8L4F8|RPO3_NICSY1e-43DNA-directed RNA polymerase 3, chloroplast precursor (EC 2.7.7.6) (T7 bacterioph717012711 (2)gb:NTA416571_16913962e-31Nicotiana tabacum partial nictaRpoT1-tom gene for mitochondrial RNA polymerase,

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043I23+ CAGGGATGCAGGATTACATTTTNG
rJMSF030F16+ TTCACACATGATGTTGACTGCCATTGCTTGCAGGGATGCAGGATTACATTTT-G
                      ____________________________________________________________
consensus TTCACACATGATGTTGACTGCCATTGCTTGCAGGGATGCAGGATTACATTTTNG
 
. : . : . : . : . : . :
rJMSF043I23+ CAGGAGTGCATGATTCCTTTTGGACACATGCTTGTGACGTTGACCAGATGAATTGTATAC
rJMSF030F16+ CAGGAGTGCATGATTCCTTTTGGACACATGCTTGTGACGTTGACCAGATGAATTGTATAC
                      ____________________________________________________________
consensus CAGGAGTGCATGATTCCTTTTGGACACATGCTTGTGACGTTGACCAGATGAATTGTATAC
 
. : . : . : . : . : . :
rJMSF043I23+ TAAGAGAGAAGTTCGTGGAGTTATACGATGTGCCGATTCTTGAAAATCTGCTTGAAAGCT
rJMSF030F16+ TAAGAGAGAAGTTCGTGGAGTTATACGATGTGCCGATTCTTGAAAATCTGCTTGAAAGCT
                      ____________________________________________________________
consensus TAAGAGAGAAGTTCGTGGAGTTATACGATGTGCCGATTCTTGAAAATCTGCTTGAAAGCT
 
. : . : . : . : . : . :
rJMSF043I23+ TCCAGGCATCATTTCCAGCATTGACTTTCCCCCCTCTACCAGAACGAGGCAATTTTGATA
rJMSF030F16+ TCCAGGCATCATTTCCAGCATTGACTTTCCCCCCTCTACCAGAACGAGGCAATTTTGATA
                      ____________________________________________________________
consensus TCCAGGCATCATTTCCAGCATTGACTTTCCCCCCTCTACCAGAACGAGGCAATTTTGATA
 
. : . : . : . : . : . :
rJMSF043I23+ TGCGAGAAGTTCTCAAGTCTCCCTATTTCTTCAACTGAACCGCCGCCATTCACCATCATT
rJMSF030F16+ TGCGAGAAGTTCTCAAGTCTCCCTATTTCTTCAACTGAACCGCCGCCATTCACCATCATT
                      ____________________________________________________________
consensus TGCGAGAAGTTCTCAAGTCTCCCTATTTCTTCAACTGAACCGCCGCCATTCACCATCATT
 
. : . : . : . : . : . :
rJMSF043I23+ GCTGAAAGCCCTTCTGCAAATAGCAGCAGCTATTTCTTCTCAGACATGAATAGGCACAAG
rJMSF030F16+ GCTGAAAGCCCTTCTGCAAATAGCAGCAGCTATTTCTTCTCAGACATGAATAGGCACAAG
                      ____________________________________________________________
consensus GCTGAAAGCCCTTCTGCAAATAGCAGCAGCTATTTCTTCTCAGACATGAATAGGCACAAG
 
. : . : . : . : . : . :
rJMSF043I23+ TCACATAGAAGAATTGTTGGCTCTTCGCCCATGCACGAGCTCAAATTTCTCTCGGTATGA
rJMSF030F16+ TCACATAGAAGAATTGTTGGCTCTTCGCCCATGCACGAGCTCAAATTTCTCTCGGTATGA
                      ____________________________________________________________
consensus TCACATAGAAGAATTGTTGGCTCTTCGCCCATGCACGAGCTCAAATTTCTCTCGGTATGA
 
. : . : . : . : . : . :
rJMSF043I23+ AGATCATGCTCTTTCTTGCATAGTCTTGTCACTCGGGTGTCTCTCTGCAAAACAAAGTTA
rJMSF030F16+ AGATCATGCTCTTTCTTGCATAGTCTTGTCACTCGGGTGTCTCTCTGCAAAACAAAGTTA
                      ____________________________________________________________
consensus AGATCATGCTCTTTCTTGCATAGTCTTGTCACTCGGGTGTCTCTCTGCAAAACAAAGTTA
 
. : . : . : . : . : . :
rJMSF043I23+ GCGCGGCAAAATTCTTGCTCCACCACACATGAGATCTGTAACATAAATATTGGCATCCCA
rJMSF030F16+ GCGCGGCAAAATTCTTGCTCCACCACACATGAGATCTGTAACATAAATATTGGCATCCCA
                      ____________________________________________________________
consensus GCGCGGCAAAATTCTTGCTCCACCACACATGAGATCTGTAACATAAATATTGGCATCCCA
 
. : . : . : . : . : . :
rJMSF043I23+ GCTTCTCTATTACAGAAACAGATGGGAAAAGAAGCACAGTAGTACACTGCAGTTCTGCTT
rJMSF030F16+ GCTTCTCTATTACAGAAACAGATGGGAAAAGAAGCACAGTAGTACACTGCAGTTCTGCTT
                      ____________________________________________________________
consensus GCTTCTCTATTACAGAAACAGATGGGAAAAGAAGCACAGTAGTACACTGCAGTTCTGCTT
 
. : . : . : . : . : . :
rJMSF043I23+ CTGGAGCCACCATTAAATTTAGATTATTGCTAGAAATATTTCTTTTAGATGCTCTAAAGA
rJMSF030F16+ CTGGAGCCACCATTAAATTTAGATTATTGCTAGAAATATTTCTTTTAGATGCTCTAAAGA
                      ____________________________________________________________
consensus CTGGAGCCACCATTAAATTTAGATTATTGCTAGAAATATTTCTTTTAGATGCTCTAAAGA
 
. : . : . : . : . : . :
rJMSF043I23+ CTAAAGGTACCTCTTTTGGGAACTCTTTAGGTGATGAATGTAACAATAGGGGTAGAAAAT
rJMSF030F16+ CTAAAGGTACCTCTTTTGGGAACTCTTTAGGTGATGAATGTAACAATAGGGGTAGAAAAT
                      ____________________________________________________________
consensus CTAAAGGTACCTCTTTTGGGAACTCTTTAGGTGATGAATGTAACAATAGGGGTAGAAAAT
 
. : . : . : . : . : . :
rJMSF043I23+ ACTTTCTTCCTGAGTGCTGTAAAAATTTGAATA
rJMSF030F16+ ACTTTCTTCCTGAGTGCTGTAAAAATTTGAATACCAGGCTGAACCCTTGTATATGAAAAT
                      ____________________________________________________________
consensus ACTTTCTTCCTGAGTGCTGTAAAAATTTGAATACCAGGCTGAACCCTTGTATATGAAAAT