Previous Contig 012707:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030E12Sequence686012707 (3)pir|T05274|T052743e-672'-hydroxyisoflavone reductase (EC 1.3.1.45) T4L20.120 - Arabidopsis thaliana>gb745012707 (3)pir|T05274|T052746e-792'-hydroxyisoflavone reductase (EC 1.3.1.45) T4L20.120 - Arabidopsis thaliana>gb
JMSF036G20Sequence115019897gb:AJ630657_18127700.001Cicer arietinum mRNA for putative universal stress protein (Usp gene).731012707 (3)pir|T05274|T052742e-762'-hydroxyisoflavone reductase (EC 1.3.1.45) T4L20.120 - Arabidopsis thaliana>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030E12- GGAGTTTCGGAAGCCGGAGCTCCGGTGGTTAGGACTTAGGATA
                      ____________________________________________________________
consensus GGAGTTTCGGAAGCCGGAGCTCCGGTGGTTAGGACTTAGGATA
 
. : . : . : . : . : . :
JMSF030E12- ACGACGGCGGTATGGAGATGAAGGCGGAGAAGAGCAAGATATTAGTAATCGGAGTAACAG
                      ____________________________________________________________
consensus ACGACGGCGGTATGGAGATGAAGGCGGAGAAGAGCAAGATATTAGTAATCGGAGTAACAG
 
. : . : . : . : . : . :
JMSF030E12- GGCGGCTAGGTTTTGAGCTAGCTAAGGCCAGCATCAACGCCTCTCATCCTACATTCGGCC
                      ____________________________________________________________
consensus GGCGGCTAGGTTTTGAGCTAGCTAAGGCCAGCATCAACGCCTCTCATCCTACATTCGGCC
 
. : . : . : . : . : . :
JMSF030E12- TCGTCAGAGACTCCGCATTTTCCGATCCCCACAAATCACAAAAACTTCACTTGCTCTCCC
                      ____________________________________________________________
consensus TCGTCAGAGACTCCGCATTTTCCGATCCCCACAAATCACAAAAACTTCACTTGCTCTCCC
 
. : . : . : . : . : . :
JMSF030E12- ACTCCGGCGTCACGCTTCTTAAGGGTTCATTGCAAGATGAAGAAAGCCTCATTGAAGCAA
                      ____________________________________________________________
consensus ACTCCGGCGTCACGCTTCTTAAGGGTTCATTGCAAGATGAAGAAAGCCTCATTGAAGCAA
 
. : . : . : . : . : . :
JMSF030E12- TCAAGCGAGTTGATGTTGTAATATGTGCCGTTTCATCGAAGCAAGTCCCGGAGCAAAAGC
                      ____________________________________________________________
consensus TCAAGCGAGTTGATGTTGTAATATGTGCCGTTTCATCGAAGCAAGTCCCGGAGCAAAAGC
 
. : . : . : . : . : . :
JMSF030E12- TTCTTATTCCGGCTATCAAAAAAGCTGGTTGCGTCAAGAGGTTCATTCCTTCAGAATTTG
rJMSF036G20+ CTTCAGAATTTG
rJMSF030E12+ AAGAGGTTCANTCCTTCAGAATTTG
                      ____________________________________________________________
consensus TTCTTATTCCGGCTATCAAAAAAGCTGGTTGCGTCAAGAGGTTCATTCCTTCAGAATTTG
 
. : . : . : . : . : . :
JMSF030E12- GGTTGGATGCTGACAAAACACGGGTTTCCAACATGGATAACAACTTCTATTCAAATAAAG
rJMSF036G20+ GGNTGGATGCTGACAAAACACGGGTTTCCAACATGGATAACAACTTCTATTCAAATAAAG
rJMSF030E12+ GGTTGGATGCTGACAAAACACGGGTTTCCAACATGGATAACAACTTCTATTCAAATAAAG
                      ____________________________________________________________
consensus GGTTGGATGCTGACAAAACACGGGTTTCCAACATGGATAACAACTTCTATTCAAATAAAG
 
. : . : . : . : . : . :
JMSF030E12- CTGAAATTAGGCGAATTGTTGAAGCTGAAGGCATTCCTTACACCTTGGTCTGCTGCAACT
rJMSF036G20+ CTGAAATTAGGCGAATTGTTGAAGCTGAAGGCATTCCTTACACCTTGGTCTGCTGCAACT
rJMSF030E12+ CTGAAATTAGGCGAATTGTTGAAGCTGAAGGCATTCCTTACACCTTGGTCTGCTGCAACT
                      ____________________________________________________________
consensus CTGAAATTAGGCGAATTGTTGAAGCTGAAGGCATTCCTTACACCTTGGTCTGCTGCAACT
 
. : . : . : . : . : . :
JMSF030E12- TCTTCACAAGTTATTTATTGCCATCGCTTGTTCAGCCAGGCCTGAAAGCCCCTCCNAGAG
rJMSF036G20+ TCTTCACAAGTTATTTATTGCCATCGCTTGTTCAGCCAGGCCTGAAAGCCCCTCCAAGAG
rJMSF030E12+ TCTTCACAAGTTATTTATTGCCATCGCTTGTTCAGCCAGGCCTGAAAGCCCCTCCAAGAG
                      ____________________________________________________________
consensus TCTTCACAAGTTATTTATTGCCATCGCTTGTTCAGCCAGGCCTGAAAGCCCCTCCAAGAG
 
. : . : . : . : . : . :
JMSF030E12- ACAAAGTCAGTATATTTGGAGACGGAACTGTTAAAGGTGTATTCATGAAGGAAAATGATG
rJMSF036G20+ ACAAAGTCAGTATATTTGGAGACGGAACTGTTAAAGGTGTATTCATGAAGGAAAATGATG
rJMSF030E12+ ACAAAGTCAGTATATTTGGAGACGGAACTGTTAAAGGTGTATTCATGAAGGAAAATGATG
                      ____________________________________________________________
consensus ACAAAGTCAGTATATTTGGAGACGGAACTGTTAAAGGTGTATTCATGAAGGAAAATGATG
 
. : . : . : . : . : . :
JMSF030E12- TTGCTGCTTTTACCATCAACACAGTGGATGATCCGCGAACATT
rJMSF036G20+ TTGCTGCTTTTACCATCAACACAGTGGATGATCCGCGAACATTGAATAAAGTGCTATACC
rJMSF030E12+ TTGCTGCTTTTACCATCAACACAGTGGATGATCCGCGAACATTGAATAAAGTGCTATACC
                      ____________________________________________________________
consensus TTGCTGCTTTTACCATCAACACAGTGGATGATCCGCGAACATTGAATAAAGTGCTATACC
 
. : . : . : . : . : . :
rJMSF036G20+ TTAGGCCGCCTGGAAATGTATGTTCTATGAATGAGTTGGTTGAGATCTGGGAGGGAAAAA
rJMSF030E12+ TTAGGCCGCCTGGAAATGTATGTTCTATGAATGAGTTGGTTGAGATCTGGGAGGGAAAAA
                      ____________________________________________________________
consensus TTAGGCCGCCTGGAAATGTATGTTCTATGAATGAGTTGGTTGAGATCTGGGAGGGAAAAA
 
. : . : . : . : . : . :
rJMSF036G20+ TTAGTAAGAAACTGGAGAAGAACTATGTATCAGAAGAGGAACTCCTAATGAAGATTAAAG
rJMSF030E12+ TTAGTAAGAAACTGGAGAAGAACTATGTATCAGAAGAGGAACTCCTAATGAAGATTAAAG
                      ____________________________________________________________
consensus TTAGTAAGAAACTGGAGAAGAACTATGTATCAGAAGAGGAACTCCTAATGAAGATTAAAG
 
. : . : . : . : . : . :
rJMSF036G20+ CAACTCCCTATCCTGACAATATGGAGATGGTTTTCATATACTCTGCATTTGTCAAAGGGG
rJMSF030E12+ CAACTCCCTATCCTGACAATATGGAGATGGTTTTCATATACTCTGCATTTGTCAAAGGGG
                      ____________________________________________________________
consensus CAACTCCCTATCCTGACAATATGGAGATGGTTTTCATATACTCTGCATTTGTCAAAGGGG
 
. : . : . : . : . : . :
rJMSF036G20+ ATCAGACCTACTTTGATGTTGAACTGGAAGGGTCACAACTTTATCCACATACAAAATACA
rJMSF030E12+ ATCAGACCTACTTTGATGTTGAACTGGAAGGGTCACAACTTTATCCACATACAAAATACA
                      ____________________________________________________________
consensus ATCAGACCTACTTTGATGTTGAACTGGAAGGGTCACAACTTTATCCACATACAAAATACA
 
. : . : . : . : . : . :
rJMSF036G20+ CCACCATAAGCGAGTTTCTTGAAACGCTGGTGTAAGATCCCCTGTTGTGGAATATTCATC
rJMSF030E12+ CCACCATAAGCGAGTTTCTTGAAACGCTGGTGTAAGATCCCCTGTTGTGGAATATTCATC
                      ____________________________________________________________
consensus CCACCATAAGCGAGTTTCTTGAAACGCTGGTGTAAGATCCCCTGTTGTGGAATATTCATC
 
. : . : . : . : . : . :
rJMSF036G20+ TACATTCGGAACTAGTATGTCTCTTTTAATGCATAGCGAGGTTTACAATTCATGCGAGTG
rJMSF030E12+ TACATTCGGAACTAGTATGTCTCTTTTAATGCATAGCGAGGTTTACAATTCATGCGAGTG
                      ____________________________________________________________
consensus TACATTCGGAACTAGTATGTCTCTTTTAATGCATAGCGAGGTTTACAATTCATGCGAGTG
 
. : . : . : . : . : . :
rJMSF036G20+ CACTTTTCTTTAGTGTCATTGTTGCTTGGACTGGATTGTCAATGTCCTTTTATGAACCT
rJMSF030E12+ CACTTTTCTTTAGTGTCATTGTTGCTTGGACTGGATTGTCAATGTCCTTTTATGAACCTT
                      ____________________________________________________________
consensus CACTTTTCTTTAGTGTCATTGTTGCTTGGACTGGATTGTCAATGTCCTTTTATGAACCTT