Previous Contig 012704:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014C06Sequence434006759 (3)gb:AY519547_16109742e-07Arabidopsis thaliana MYB transcription factor (At1g58220) mRNA, complete cds.>gb773012704 (4)gb:AF531949_12797135e-05Drosophila yakuba CG10911 mRNA, partial cds.
JMSF030D16Sequence747012704 (4)gb:AE013599_11323730.035Drosophila melanogaster chromosome 2R, complete sequence.>gb:AE003804_1225353 Dr
JMSF031L20Sequence650006759 (3)gb:AY519547_16109745e-20Arabidopsis thaliana MYB transcription factor (At1g58220) mRNA, complete cds.>gb668012704 (4)gb:AE013599_11323730.028Drosophila melanogaster chromosome 2R, complete sequence.>gb:AE003804_1225353 Dr
JMSF044K21Sequence804006759 (3)gb:AY519547_16109742e-27Arabidopsis thaliana MYB transcription factor (At1g58220) mRNA, complete cds.>gb702012704 (4)gb:AE013599_11323730.030Drosophila melanogaster chromosome 2R, complete sequence.>gb:AE003804_1225353 Dr

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014C06+ CCAAATNGTACCNACTCTACTCCAG
                      ____________________________________________________________
consensus CCAAATNGTACCNACTCTACTCCAG
 
. : . : . : . : . : . :
rJMSF014C06+ CATCTGAGCTTGACACAAAAACTGCAAAGGATTCTGTTATCTCTGGCTCGGAAACTGTAA
rJMSF044K21+ TCGGAAACTGTAA
                      ____________________________________________________________
consensus CATCTGAGCTTGACACAAAAACTGCAAAGGATTCTGTTATCTCTGGCTCGGAAACTGTAA
 
. : . : . : . : . : . :
rJMSF031L20+ GGAAAAGCCAGCCAAAGAGAGTCGAGCACCTGGCCCATGCAATTCCCCTGAAGGCAATA
rJMSF014C06+ TGGAAAAGCCAGCCAAAGAGAGTCGAGCACCTGGCCCATGCAATTCCCCTGAAGGCAATA
rJMSF044K21+ TGGAAAAGCCAGNCAAAGAGAGTCGAGCACCTGGCCCATGCAATTCCCCTGAAGGCAATA
rJMSF030D16+ GCCCATGCAATTCCCCTGAAGGCAATA
                      ____________________________________________________________
consensus TGGAAAAGCCAGCCAAAGAGAGTCGAGCACCTGGCCCATGCAATTCCCCTGAAGGCAATA
 
. : . : . : . : . : . :
rJMSF031L20+ AAGCTGCTTCCACCAAAGAAGTGCCATTGGAGTTGGCCCAAGTGGACCAAACTGCTATTC
rJMSF014C06+ AAGCTGCTTCCACCAAAGAAGTGCCATTGGAGTTGGCCCAAGTGGACCAAACTGCTATTC
rJMSF044K21+ AAGCTGCTTCCACCAAAGAAGTGCCATTGGAGTTGGCCCAAGTGGACCAAACTGCTATTC
rJMSF030D16+ AAGCTGCTTCCACCAAAGAAGTGCCATTGGAGTTGGCCCAAGTGGACCAAACTGCTATTC
                      ____________________________________________________________
consensus AAGCTGCTTCCACCAAAGAAGTGCCATTGGAGTTGGCCCAAGTGGACCAAACTGCTATTC
 
. : . : . : . : . : . :
rJMSF031L20+ CAGCCAAAGAGAAGATTGAAGAAACTTGTTTTTCAGGTGATGCACCAAAGGAGAATGGAC
rJMSF014C06+ CAGCCAAAGAGAAGATTGAAGAAACTTGTTTTTCAGGTGATGCACCAAAGGAGAATGGAC
rJMSF044K21+ CAGCCAAAGAGAAGATTGAAGAAACTTGTTTTTCAGGTGATGCACCAAAGGAGAATGGAC
rJMSF030D16+ CAGCCAAAGAGAAGATTGAAGAAACTTGTTTTTCAGGTGATGCACCAAAGGAGAATGGAC
                      ____________________________________________________________
consensus CAGCCAAAGAGAAGATTGAAGAAACTTGTTTTTCAGGTGATGCACCAAAGGAGAATGGAC
 
. : . : . : . : . : . :
rJMSF031L20+ AAAGGGATCAAGCCTCTGTTTCTACAGCTAGTGCTGCAAACATTTGTGTTCAAGAAAAGC
rJMSF014C06+ AAAGGGATCAAGCCTCTGTTTCTACAGCTAGTGCTGCAAACATTTGTGTTCAAGAAAAGC
rJMSF044K21+ AAAGGGATCAAGCCTCTGTTTCTACAGCTAGTGCTGCAAACATTTGTGTTCAAGAAAAGC
rJMSF030D16+ AAAGGGATCAAGCCTCTGTTTCTACAGCTAGTGCTGCAAACATTTGTGTTCAAGAAAAGC
                      ____________________________________________________________
consensus AAAGGGATCAAGCCTCTGTTTCTACAGCTAGTGCTGCAAACATTTGTGTTCAAGAAAAGC
 
. : . : . : . : . : . :
rJMSF031L20+ AAATCAACTCTTCATCAACGACTGATGTAACTACAGTCAAATGTTCTGCTAATGACCGCA
rJMSF014C06+ AAATCAACTCTTCATCAACGACTGATGTAACTACAGTCAAATGTTCTGCTAATGACCGCA
rJMSF044K21+ AAATCAACTCTTCATCAACGACTGATGTAACTACAGTCAAATGTTCTGCTAATGACCGCA
rJMSF030D16+ AAATCAACTCTTCATCAACGACTGATGTAACTACAGTCAAATGTTCTGCTAATGACCGCA
                      ____________________________________________________________
consensus AAATCAACTCTTCATCAACGACTGATGTAACTACAGTCAAATGTTCTGCTAATGACCGCA
 
. : . : . : . : . : . :
rJMSF031L20+ ACCAGGCTGAGGTTGAGTGTGCAAGCTCAAATGACAACAGTGCAATAGTTTCACCAGTTG
rJMSF014C06+ ACCAGGCTGAGGTTGAGTGTGCAAGCTCAAATGACAACAGTGCAATAGTTTCACCAGTTG
rJMSF044K21+ ACCAGGCTGAGGTTGAGTGTGCAAGCTCAAATGACAACAGTGCAATAGTTTCACCAGTTG
rJMSF030D16+ ACCAGGCTGAGGTTGAGTGTGCAAGCTCAAATGACAACAGTGCAATAGTTTCACCAGTTG
                      ____________________________________________________________
consensus ACCAGGCTGAGGTTGAGTGTGCAAGCTCAAATGACAACAGTGCAATAGTTTCACCAGTTG
 
. : . : . : . : . : . :
rJMSF031L20+ GGAACACTAGCAAGGAGATGAATGAAAAGCAACCCGCAAATAGAAATCAAATAGACCCGT
rJMSF014C06+ GGAACACTAGCAAGGAGATGAATGAAAAGCAACCCGCAAATAGAAATCAAATAGACCCGT
rJMSF044K21+ GGAACACTAGCAAGGAGATGAATGAAAAGCAACCCGCAAATAGAAATCAAATAGACCCGT
rJMSF030D16+ GGAACACTAGCAAGGAGATGAATGAAAAGCAACCCGCAAATAGAAATCAAATAGACCCGT
                      ____________________________________________________________
consensus GGAACACTAGCAAGGAGATGAATGAAAAGCAACCCGCAAATAGAAATCAAATAGACCCGT
 
. : . : . : . : . : . :
rJMSF031L20+ CGAGTATGGCTGTGGATGGGGCTGATGAGGAAGTAACTTGAAGAGAGAATACTGGAGAGT
rJMSF014C06+ CGAGTATGGCTGTGGATGGGGCTGATGAGGAAGTAACTTGAAGAGAGAATACTGGAGAGT
rJMSF044K21+ CGAGTATGGCTGTGGATGGGGCTGATGAGGAAGTAACTTGAAGAGAGAATACTGGAGAGT
rJMSF030D16+ CGAGTATGGCTGTGGATGGGGCTGATGAGGAAGTAACTTGAAGAGAGAATACTGGAGAGT
                      ____________________________________________________________
consensus CGAGTATGGCTGTGGATGGGGCTGATGAGGAAGTAACTTGAAGAGAGAATACTGGAGAGT
 
. : . : . : . : . : . :
rJMSF031L20+ AATGGCGTTCTCTTGGTCCTCCATTGTACGTATTGTTTGATTCTCAACCACTGCAGTATA
rJMSF014C06+ AATGGCGTTCTCTTGGTCCTCCATTGTACGTATTGTTTGATTCTCAACCACTGCAGTATA
rJMSF044K21+ AATGGCGTTCTCTTGGTCCTCCATTGTACGTATTGTTTGATTCTCAACCACTGCAGTATA
rJMSF030D16+ AATGGCGTTCTCTTGGTCCTCCATTGTACGTATTGTTTGATTCTCAACCACTGCAGTATA
                      ____________________________________________________________
consensus AATGGCGTTCTCTTGGTCCTCCATTGTACGTATTGTTTGATTCTCAACCACTGCAGTATA
 
. : . : . : . : . : . :
rJMSF031L20+ CCCAAACACCCCCCACCTTCCTTCCCTGTTTGCCATTTCTTTTCTCTATATAGGTTTGTA
rJMSF014C06+ CCCAAACACCCCCCACCTTCCTTCCCTGTTTGCCATTTCTTTTCTCTATATAGGTTTGTA
rJMSF044K21+ CCCAAACACCCCCCACCTTCCTTCCCTGTTTGCCATTTCTTTTCTCTATATAGGTTTGTA
rJMSF030D16+ CCCAAACACCCCCCACCTTCCTTCCCTGTTTGCCATTTCTTTTCTCTATATAGGTTTGTA
                      ____________________________________________________________
consensus CCCAAACACCCCCCACCTTCCTTCCCTGTTTGCCATTTCTTTTCTCTATATAGGTTTGTA
 
. : . : . : . : . : . :
rJMSF031L20+ GATGTAGCACGCAAAGAAAGGTATACAGTGTTTATATATCTGTATGGCCTGTGTAAACTA
rJMSF014C06+ GATGTAGCACGCAAAGAAAGGTATACAGTGTTTATATATCTGTATGGCCTGTGTAAACTA
rJMSF044K21+ GATGTAGCACGCAAAGAAAGGTATACAGTGTTTATATATCTGTATGGCCTGTGTAAACTA
rJMSF030D16+ GATGTAGCACGCAAAGAAAGGTATACAGTGTTTATATATCTGTATGGCCTGTGTAAACTA
                      ____________________________________________________________
consensus GATGTAGCACGCAAAGAAAGGTATACAGTGTTTATATATCTGTATGGCCTGTGTAAACTA
 
. : . : . : . : . : . :
rJMSF031L20+ ATATTTTTT
rJMSF014C06+ ATATTTTTTTTAATTGTTTCTGTATGGA
rJMSF044K21+ ATATTTTTTTTAATTGTTTCTGTATGGA
rJMSF030D16+ ATATTTTTTTTAATTGTTTCTGTATGGATGGTTAAATATGTTAATGAGCTATAGTGAGTT
                      ____________________________________________________________
consensus ATATTTTTTTTAATTGTTTCTGTATGGATGGTTAAATATGTTAATGAGCTATAGTGAGTT
 
. : . : . : . : . : . :
rJMSF030D16+ ATAGTGAGTCTCACCCCATCAGCCTACTTTGAAAGTACTACTAATATGAGGAATTTTTTT
                      ____________________________________________________________
consensus ATAGTGAGTCTCACCCCATCAGCCTACTTTGAAAGTACTACTAATATGAGGAATTTTTTT