Previous Contig 012703:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030C23Sequence627004588 (33)gb:STU307031_17230412e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).579012703 (2)gb:AB061265_15220263e-13Solanum tuberosum StLTSR mRNA for low temperature and salt responsive protein, c
JMSF031L13Sequence441012703 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031L13+ TTTTTTTTTTAAAACATATACTAGTATTTATC
                      ____________________________________________________________
consensus TTTTTTTTTTAAAACATATACTAGTATTTATC
 
. : . : . : . : . : . :
JMSF031L13+ ATAAAAATATAAAGCCGTGTCACAGCACGTTACAAATGAAGTAGACACTACG-TAGGAAA
rJMSF030C23- GTTACANATGAAGTAGACACTACGTTAGGANA
                      ____________________________________________________________
consensus ATAAAAATATAAAGCCGTGTCACAGCACGTTACAAATGAAGTAGACACTACGTTAGGAAA
 
. : . : . : . : . : . :
JMSF031L13+ ATGACCCTCACAATTATCATAATCAACTACTCTTCAACTTTGGCATTTGGCAACGTAACA
rJMSF030C23- ATGACCCTCACAATTATCATAATCAACTACTCTTCAACTTTGGCATTTGGCAACGTAACA
                      ____________________________________________________________
consensus ATGACCCTCACAATTATCATAATCAACTACTCTTCAACTTTGGCATTTGGCAACGTAACA
 
. : . : . : . : . : . :
JMSF031L13+ GCACTTCTAGAACAGGAGAATAAACTAAAAATGGTGAAAACCAAACAAGTAAAATAAAAT
rJMSF030C23- GCACTTCTAGAACNGGAGAATAAACTAAAAATGGTGAAAACCAAACAAGTAAAATAAAAT
                      ____________________________________________________________
consensus GCACTTCTAGAACAGGAGAATAAACTAAAAATGGTGAAAACCAAACAAGTAAAATAAAAT
 
. : . : . : . : . : . :
JMSF031L13+ CCGACGTAGGCGTGACCACATCGAGTCATTAACAGTGTTCACAAAACAAATAATGGCGAC
rJMSF030C23- CCGACGTAGGCGTGACCACATCGAGTCATTAACAGTGTTCACAAAACAAATAATGGCGAC
                      ____________________________________________________________
consensus CCGACGTAGGCGTGACCACATCGAGTCATTAACAGTGTTCACAAAACAAATAATGGCGAC
 
. : . : . : . : . : . :
JMSF031L13+ AATGACATAATTAGTATATATAACACTCCAATAATTATTGACACAAATTTAATGATTAAT
rJMSF030C23- AATGACATAATTAGTATATATAACACTCCAATAATTATTGACACAAATTTAATGATTAAT
                      ____________________________________________________________
consensus AATGACATAATTAGTATATATAACACTCCAATAATTATTGACACAAATTTAATGATTAAT
 
. : . : . : . : . : . :
JMSF031L13+ AAAATGCATGGCCACCTTCACATCGATCCCTACCTGATAGCTTAGAAAGTTTAATTTATC
rJMSF030C23- AAAATGCATGGCCACCTTCACATCGATCTCTACCTGATAGCTTAGAAAGTTTAATTTATC
                      ____________________________________________________________
consensus AAAATGCATGGCCACCTTCACATCGATCTCTACCTGATAGCTTAGAAAGTTTAATTTATC
 
. : . : . : . : . : . :
JMSF031L13+ ACTTGGTGATGATCCAAATAGCATAGATAATTCCAGGGATGTACCCAAAC
rJMSF030C23- ACTTGGTGATGATCCAAATAGCATAGATAATTCCAGGGATGTACCCAAACAGAGTCAGCA
                      ____________________________________________________________
consensus ACTTGGTGATGATCCAAATAGCATAGATAATTCCAGGGATGTACCCAAACAGAGTCAGCA
 
. : . : . : . : . : . :
rJMSF030C23- AACAGCAAATCCAAAACTCAATCTTGCAGCCAAACTTGAGGAAGACACCTAGGGGAGGCA
                      ____________________________________________________________
consensus AACAGCAAATCCAAAACTCAATCTTGCAGCCAAACTTGAGGAAGACACCTAGGGGAGGCA
 
. : . : . : . : . : . :
rJMSF030C23- ACAAGATAGCCAGGAGAATGTCTACACAAGTGGCTGTGCTGCCCATTTTTATGATCAACT
                      ____________________________________________________________
consensus ACAAGATAGCCAGGAGAATGTCTACACAAGTGGCTGTGCTGCCCATTTTTATGATCAACT
 
. : . : . : . : . : . :
rJMSF030C23- CAATGAAGAAACCGAAAAGAAAAGGAAGTAAATTAAAGTAACCCCTTTAATTTGGTAGAT
                      ____________________________________________________________
consensus CAATGAAGAAACCGAAAAGAAAAGGAAGTAAATTAAAGTAACCCCTTTAATTTGGTAGAT