Previous Contig 012701:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008O08Sequence251006647 (4)gb:AY084430_15695205e-06Arabidopsis thaliana clone 108165 mRNA, complete sequence.779012701 (4)gb:AP004111_18377494e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMSF030C19Sequence648006647 (4)gb:AY084430_15695201e-59Arabidopsis thaliana clone 108165 mRNA, complete sequence.705012701 (4)gb:AY084430_15695204e-16Arabidopsis thaliana clone 108165 mRNA, complete sequence.
JMSF042O02Sequence749006647 (4)gb:AY084430_15695202e-56Arabidopsis thaliana clone 108165 mRNA, complete sequence.840012701 (4)pir|G96757|G967571e-36probable protein ATPase T18K17.15 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF047M14Sequence680006647 (4)pir|G96757|G967574e-46probable protein ATPase T18K17.15 [imported] - Arabidopsis thaliana>gb:AE005173_770012701 (4)gb:AP004111_18377495e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042O02+ CTTNGGAAACTTACCCGGTGATAT
                      ____________________________________________________________
consensus CTTNGGAAACTTACCCGGTGATAT
 
. : . : . : . : . : . :
rJMSF047M14+ AAGCTGAATTATCAGT
rJMSF042O02+ GGCATTNTGGGACTATGGTNGAAAAAAGGAACTTGCAACTACTAAAGCTGAATTATCAGT
rJMSF008O08+ ATCAGT
                      ____________________________________________________________
consensus GGCATTNTGGGACTATGGTNGAAAAAAGGAACTTGCAACTACTAAAGCTGAATTATCAGT
 
. : . : . : . : . : . :
rJMSF047M14+ GACAAGTGAATGGTCTCCGGATGGACGTTA-TTTTATGACTGCCACAACAGCTCCTAGAC
rJMSF042O02+ GACAAGTGAATGGTCTCCGGATGGACGTTATTTTTATGACTGCCACAACAGCTCCTAGAC
rJMSF008O08+ GACAAGTGAATGGTCTCCGGATGGACGTTA-TTTTATGACTGCCACAACAGCTCCTAGAC
                      ____________________________________________________________
consensus GACAAGTGAATGGTCTCCGGATGGACGTTA-TTTTATGACTGCCACAACAGCTCCTAGAC
 
. : . : . : . : . : . :
rJMSF047M14+ TCCAAGTTGACAATGGGATTAAGGTCTTTCATCACAATGGATCACTGTACTTCAAGAAGA
rJMSF042O02+ TCCAAGTTGACAATGGGATTAAGGTCTTTCATCACAATGGATCACTGTACTTCAAGAAGA
rJMSF008O08+ TCCAAGTTGACAATGGGATTAAGGTCTTTCATCACAATGGATCACTGTACTTCAAGAAGA
rJMSF030C19+ GGATTAAGGTCTTTCATCACAATGGATCACTGTACTTCAAGAAGA
                      ____________________________________________________________
consensus TCCAAGTTGACAATGGGATTAAGGTCTTTCATCACAATGGATCACTGTACTTCAAGAAGA
 
. : . : . : . : . : . :
rJMSF047M14+ TGTTTGAAAAATTGTACCAGGCTGACTGGAAACCTGAGTCCCCAGATAAGTTTGGTGAAA
rJMSF042O02+ TGTTTGAAAAATTGTACCAGGCTGACTGGAAACCTGAGTCCCCAGATAAGTTTGGTGAAA
rJMSF008O08+ TGTTTGAAAAATTGTACCAGGCTGACTGGAAACCTGAGTCCCCAGATAAGTTTGGTGAAA
rJMSF030C19+ TGTTTGAAAAATTGTACCAGGCTGACTGGAAACCTGAGTCCCCAGATAAGTTTGGTGAAA
                      ____________________________________________________________
consensus TGTTTGAAAAATTGTACCAGGCTGACTGGAAACCTGAGTCCCCAGATAAGTTTGGTGAAA
 
. : . : . : . : . : . :
rJMSF047M14+ TTTCAGAATTTTTGAAGGCTGTTGACTCCCTGAAAATTGACGAAACCAAAGTTCAAGGAC
rJMSF042O02+ TTTCAGAATTTTTGAAGGCTGTTGACTCCCTGAAAATTGACGAAACCAAAGTTCAAGGAC
rJMSF008O08+ TTTCAGAATTTTTGAAGGCTGTTGACTCCCTGAAAATTGACGAAACCAAAGTTCAAGGAC
rJMSF030C19+ TTTCAGAATTTTTGAAGGCTGTTGACTCCCTGAAAATTGACGAAACCAAAGTTCAAGGAC
                      ____________________________________________________________
consensus TTTCAGAATTTTTGAAGGCTGTTGACTCCCTGAAAATTGACGAAACCAAAGTTCAAGGAC
 
. : . : . : . : . : . :
rJMSF047M14+ AAGGATCAAAAGCTTCCAAACCTGCCACAAAAACTACACCTGCCAATCCTCCTGCACAAA
rJMSF042O02+ AAGGATCAAAAGCTTCCAAACCTGCCACAAAAACTACACCTGCCAATCCTCCTGCACAAA
rJMSF008O08+ AAGGATCAAAAGCTTCCAAACCTGCCACAAAAACTACACCTGCCAATCCTCCTGCACAAA
rJMSF030C19+ AAGGATCAAAAGCTTCCAAACCTGCCACAAAAACTACACCTGCCAATCCTCCTGCACAAA
                      ____________________________________________________________
consensus AAGGATCAAAAGCTTCCAAACCTGCCACAAAAACTACACCTGCCAATCCTCCTGCACAAA
 
. : . : . : . : . : . :
rJMSF047M14+ AGCCTGCTGCTTATCGTCCACCTCATGCCAAAGCTGCAGCTGCTGTCCAAGCAGAGTTAT
rJMSF042O02+ AGCCTGCTGCTTATCGTCCACCTCATGCCAAAGCTGCAGCTGCTGTCCAAGCAGAGTTAT
rJMSF008O08+ AGCCTGCTGCTTATCGTCCACCTCATGCCAAAGCTGCAGCTGCTGTCCAAGCAGAGTTAT
rJMSF030C19+ AGCCTGCTGCTTATCGTCCACCTCATGCCAAAGCTGCAGCTGCTGTCCAAGCAGAGTTAT
                      ____________________________________________________________
consensus AGCCTGCTGCTTATCGTCCACCTCATGCCAAAGCTGCAGCTGCTGTCCAAGCAGAGTTAT
 
. : . : . : . : . : . :
rJMSF047M14+ TTGGTGGAAATCCTTCAGGAGAGCTGAGCAAGAATGCACTGAAAAACAAGAAAAAGAGGG
rJMSF042O02+ TTGGTGGAAATCCTTCAGGAGAGCTGAGCAAGAATGCACTGAAAAACAAGAAAAAGAGGG
rJMSF008O08+ TTGGTGGAAATCCTTCAGGAGAGCTGAGCAAGAATGCACTGAAAAACAAGAAAAAGAGGG
rJMSF030C19+ TTGGTGGAAATCCTTCAGGAGAGCTGAGCAAGAATGCACTGAAAAACAAGAAAAAGAGGG
                      ____________________________________________________________
consensus TTGGTGGAAATCCTTCAGGAGAGCTGAGCAAGAATGCACTGAAAAACAAGAAAAAGAGGG
 
. : . : . : . : . : . :
rJMSF047M14+ AAAAACAAAAGGAGAAAAAAGCTGCTGAGGGTGCTATATAGTCAGTTCCAAGTCTACATC
rJMSF042O02+ AAAAACAAAAGGAGAAAAAAGCTGCTGAGGGTGCTATATAGTCAGTTCCAAGTCTACATC
rJMSF008O08+ AAAAACAAAAGGAGAAAAAAGCTGCTGAGGGTGCTATATAGTCAGTTCCAAGTCTACATC
rJMSF030C19+ AAAAACAAAAGGAGAAAAAAGCTGCTGAGGGTGCTATATAGTCAGTTCCAAGTCTACATC
                      ____________________________________________________________
consensus AAAAACAAAAGGAGAAAAAAGCTGCTGAGGGTGCTATATAGTCAGTTCCAAGTCTACATC
 
. : . : . : . : . : . :
rJMSF047M14+ ATCTCAAGTCTCAAGTCTTGGTCTGCTCAGGCTTAGGGCATTAGGTATTTGAGCCTTCAA
rJMSF042O02+ ATCTCAAGTCTCAAGTCTTGGTCTGCTCAGGCTTAGGGCATTAGGTATTTGAGCCTTCAA
rJMSF008O08+ ATCTCAAGTCTCAAGTCTTGGTCTGCTCAGGCTTAGGGCATTAGGTATTTGAGCCTTCAA
rJMSF030C19+ ATCTCAAGTCTCAAGTCTTGGTCTGCTCAGGCTTAGGGCATTAGGTATTTGAGCCTTCAA
                      ____________________________________________________________
consensus ATCTCAAGTCTCAAGTCTTGGTCTGCTCAGGCTTAGGGCATTAGGTATTTGAGCCTTCAA
 
. : . : . : . : . : . :
rJMSF047M14+ GCTATTCAATCATTCTGCCTATCCAAATGGCTGAAAATGTCGCCCTTGCTCGCACAATCA
rJMSF042O02+ GCTATTCAATCATTCTGCCTATCCAAATGGCTGAAAATGTCGCCCTTGCTCGCACAATCA
rJMSF008O08+ GCTATTCAATCATTCTGCCTATCCAAATGGCTGAAAATGTCGCCCTTGCTCGCACAATCA
rJMSF030C19+ GCTATTCAATCATTCTGCCTATCCAAATGGCTGAAAATGTCGCCCTTGCTCGCACAATCA
                      ____________________________________________________________
consensus GCTATTCAATCATTCTGCCTATCCAAATGGCTGAAAATGTCGCCCTTGCTCGCACAATCA
 
. : . : . : . : . : . :
rJMSF047M14+ TCATCCACGTTGGACGCTATGCCTTCTGAAAGCTTTTAAGTTTCAAAAATTTTGTACTAA
rJMSF042O02+ TCATCCACGTTGGACGCTATGCCTTCTGAAAGCTTTTAAGTTTCAAAAATTTTGTACTAA
rJMSF008O08+ TCATCCACGTTGGACGCTATGCCTTCTGAAAGCTTTTAAGTTTCAAAAATTTTGTACTAA
rJMSF030C19+ TCATCCACGTTGGACGCTATGCCTTCTGAAAGCTTTTAAGTTTCAAAAATTTTGTACTAA
                      ____________________________________________________________
consensus TCATCCACGTTGGACGCTATGCCTTCTGAAAGCTTTTAAGTTTCAAAAATTTTGTACTAA
 
. : . : . : . : . : . :
rJMSF047M14+ TGCAAAACTTTGGTCAACAATTATTTTCCATGTTCTGAAAGCTTTTAAGTTTCAAAAATT
rJMSF042O02+ TGCAAAACTTTGGTCAACAATTATTTTCCATGTTCTGAAAGCTTTTAAGTTTCAAAAATT
rJMSF008O08+ TGCAAAACTTTGGTCAACAATTATTTTCCATGTTCTGAAAGCTTTTAAGTTTCAAAAATT
rJMSF030C19+ TGCAAAACTTTGGTCAACAATTATTTTCCATGTTCTGAAAGCTTTTAAGTTTCAAAAATT
                      ____________________________________________________________
consensus TGCAAAACTTTGGTCAACAATTATTTTCCATGTTCTGAAAGCTTTTAAGTTTCAAAAATT
 
. : . : . : . : . : . :
rJMSF047M14+ TTGTACTATTGCAAAACTTTGGTCAAC
rJMSF042O02+ TTGTACTATTGCAAAACTTTGGTCAAC
rJMSF008O08+ TTGTACTATTGCAAAACTTTGGTCAACAATTATTTTCCATGTTCAGAGGCCTCT
rJMSF030C19+ TTGTACTATTGCAAAACTTTGGTCAACAATTATTTTCCATGTTCAGAGGCCTCTTGTGCT
                      ____________________________________________________________
consensus TTGTACTATTGCAAAACTTTGGTCAACAATTATTTTCCATGTTCAGAGGCCTCTTGTGCT