Previous Contig 012700:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN011E07Sequence643012700 (2)gb:BT005371_16383114e-58Arabidopsis thaliana At1g76250 mRNA, complete cds.>gb:AK118483_1816456 Arabidops
JMSF030C18Sequence676019609gb:BT005371_16383111e-41Arabidopsis thaliana At1g76250 mRNA, complete cds.>gb:AK118483_1816456 Arabidops729012700 (2)gb:BT005371_16383113e-74Arabidopsis thaliana At1g76250 mRNA, complete cds.>gb:AK118483_1816456 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN011E07+ TATAATAATATACTATATTCAATAATTCTGAT
rJMSF030C18- AATTCTGAT
                      ____________________________________________________________
consensus TATAATAATATACTATATTCAATAATTCTGAT
 
. : . : . : . : . : . :
JMFN011E07+ CTATACTAGCTAGAGTCTGCCCCTCCGGCCTATATATACAAGACAGACGGCACCGACATT
rJMSF030C18- CTATACTAGCTAGAGTCTGCCCCTCCGGCCTATATATACAAGACAGACGGCACCGACATT
                      ____________________________________________________________
consensus CTATACTAGCTAGAGTCTGCCCCTCCGGCCTATATATACAAGACAGACGGCACCGACATT
 
. : . : . : . : . : . :
JMFN011E07+ CATTAAATAATTAAAAATATAATAGTGTGGCCGGGTTTAGCCAGTCACAGTCCCAGATTT
rJMSF030C18- CATTAAATAATTAAAAATATAATAGTGTGGCCGGGTTTAGCCAGTCACAGTCCCAGATTT
                      ____________________________________________________________
consensus CATTAAATAATTAAAAATATAATAGTGTGGCCGGGTTTAGCCAGTCACAGTCCCAGATTT
 
. : . : . : . : . : . :
JMFN011E07+ TAAGCCGCCAAGCAAGCCTAGCTCGCATATCTCCACTGCAGAAGGAGCCTTCCATGATGC
rJMSF030C18- TAAGCCGCCAAGCAAGCCTAGCTCGCATATCTCCACTGCAGAAGGAGCCTTCCATGATGC
                      ____________________________________________________________
consensus TAAGCCGCCAAGCAAGCCTAGCTCGCATATCTCCACTGCAGAAGGAGCCTTCCATGATGC
 
. : . : . : . : . : . :
JMFN011E07+ CGACTTCAATTTCATCGCCTTGAAGTCCCTTATACATCCTTGAACACTCAGCTTCTTCAC
rJMSF030C18- CGACTTCAATTTCATCGCCTTGAAGTCCCTTATACATCCTTGAACACTCAGCTTCTTCAC
                      ____________________________________________________________
consensus CGACTTCAATTTCATCGCCTTGAAGTCCCTTATACATCCTTGAACACTCAGCTTCTTCAC
 
. : . : . : . : . : . :
JMFN011E07+ TCGCTTCCGGGCTGCACCCAGCTTCTTACCGGCAACTTCATCGAATAATTTCTCCCATCC
rJMSF030C18- TCGCTTCCGGGCTGCACCCAGCTTCTTACCGGCAACTTCATCGAATAATTTCTCCCATCC
                      ____________________________________________________________
consensus TCGCTTCCGGGCTGCACCCAGCTTCTTACCGGCAACTTCATCGAATAATTTCTCCCATCC
 
. : . : . : . : . : . :
JMFN011E07+ TTCCTCCCACTCCCCGTGAGCGTCGCACAGCTCTATGGTGTTGTTCGCCCAATCCGTCCA
rJMSF030C18- TTCCTCCCACTCCCCGTGAGCGTCGCACAGCTCTATGGTGTTGTTCGCCCAATCCGTCCA
                      ____________________________________________________________
consensus TTCCTCCCACTCCCCGTGAGCGTCGCACAGCTCTATGGTGTTGTTCGCCCAATCCGTCCA
 
. : . : . : . : . : . :
JMFN011E07+ GCTCCACAATTTGTTGAGGCGGCTCATTACCGGGGGAACGCAAGCCCGACTACACGCAGG
rJMSF030C18- GCTCCACAATTTGTTGAGGCGGCTCATTACCGGGGGAACGCAAGCCCGACTACACGCAGG
                      ____________________________________________________________
consensus GCTCCACAATTTGTTGAGGCGGCTCATTACCGGGGGAACGCAAGCCCGACTACACGCAGG
 
. : . : . : . : . : . :
JMFN011E07+ CTTGCAGGGCCTGCATTTTGCCCCGCTTAATGGCCCCGGGCTGGACAGTGCCGCCACGGG
rJMSF030C18- CTTGCAGGGCCTGCATTTTGCCCCGCTTAATGGCCCCGGGCTGGACAGTGCCGCCACGGG
                      ____________________________________________________________
consensus CTTGCAGGGCCTGCATTTTGCCCCGCTTAATGGCCCCGGGCTGGACAGTGCCGCCACGGG
 
. : . : . : . : . : . :
JMFN011E07+ GACCCCATTCGCCCCCGGAGGGAAGGGGTATTGCCGATCCGTTACGACGCAGAACGGGAG
rJMSF030C18- GACCCCATTCGCCCCCGGAGGGAAGGGGTATTGCCGATCCGTTACGACGCAGAACGGGAG
                      ____________________________________________________________
consensus GACCCCATTCGCCCCCGGAGGGAAGGGGTATTGCCGATCCGTTACGACGCAGAACGGGAG
 
. : . : . : . : . : . :
JMFN011E07+ GCGAATAGTCTTGTAAGGTACCTTTTGGGTTGTGAGCTGGGCCTTGAATGCGCTCTCGGA
rJMSF030C18- GCGAATAGTCTTGTAAGGTACCTTTTGGGTTGTGAGCTGGGCCTTGAATGCGCTCTCGGA
                      ____________________________________________________________
consensus GCGAATAGTCTTGTAAGGTACCTTTTGGGTTGTGAGCTGGGCCTTGAATGCGCTCTCGGA
 
. : . : . : . : . : . :
JMFN011E07+ GTTGAGCTGCG
rJMSF030C18- GTTGAGCTGCGCATGCCCCCCTGCATCCAACTGGGGAATCATGGAAAGCCGTGACAGAGC
                      ____________________________________________________________
consensus GTTGAGCTGCGCATGCCCCCCTGCATCCAACTGGGGAATCATGGAAAGCCGTGACAGAGC
 
. : . : . : . : . : . :
rJMSF030C18- CACCACAGAGGTGTTGAAGTCACCGATGCCGATTCGGTCGTTCAGGCCGCCGTACGATGA
                      ____________________________________________________________
consensus CACCACAGAGGTGTTGAAGTCACCGATGCCGATTCGGTCGTTCAGGCCGCCGTACGATGA