Previous Contig 012696:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030B16Sequence419012696 (2)gb:AY069896_15666382e-17Arabidopsis thaliana At1g31940/F5M6.6 mRNA, complete cds.>gb:AY086420_1571468 Ar732012696 (2)gb:AY069896_15666381e-37Arabidopsis thaliana At1g31940/F5M6.6 mRNA, complete cds.>gb:AY086420_1571468 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030B16- GGGCATGCCCCACTCCATCCGATTAACATTCTAGAGAGAGA
rJMSF030B16+ GAGAGAGA
                      ____________________________________________________________
consensus GGGCATGCCCCACTCCATCCGATTAACATTCTAGAGAGAGA
 
. : . : . : . : . : . :
JMSF030B16- GAGAGAGAGAGAGAGTGACAGAACAGGAAAACAAAAGCAACTCGACCAATCCGTTGTGTT
rJMSF030B16+ GAGAGAGAGAGAGAGTGACAGAACAGGAAAACAAAAGCAACTCGACCAATCCGTTGNGTT
                      ____________________________________________________________
consensus GAGAGAGAGAGAGAGTGACAGAACAGGAAAACAAAAGCAACTCGACCAATCCGTTGTGTT
 
. : . : . : . : . : . :
JMSF030B16- TTCTTTTTATTTTTATTTTTTTTTTCGTTTGTTTCCCCC-TTTTTTAGCTGGTTGTTCTT
rJMSF030B16+ TTCTTTTTATTTTTATTTTTTTTTTCGTTTGTTTCCCCCTTTTTTTAGCTGGTTGTTCTT
                      ____________________________________________________________
consensus TTCTTTTTATTTTTATTTTTTTTTTCGTTTGTTTCCCCCTTTTTTTAGCTGGTTGTTCTT
 
. : . : . : . : . : . :
JMSF030B16- CGGGTTAACATGGNGGGTATTTTTTCAAGATTTTCAGTGTCTAAAAATGGGCNCAGAAAA
rJMSF030B16+ CGGGTTAACATGGTGGGTATTTTTTCAAGATTTTCAGTGTCTAAAAATGGGCACAGAAGA
                      ____________________________________________________________
consensus CGGGTTAACATGGTGGGTATTTTTTCAAGATTTTCAGTGTCTAAAAATGGGCACAGAAGA
 
. : . : . : . : . : . :
JMSF030B16- ACTCANAGTGCACTTGATGAGAGGGAAGTGTTGCCCCCTAANCCCGAGGCGACAGTGGCT
rJMSF030B16+ ACTCAGAGTGCACTTGATGAGAGGGAAGTGTTGCCCCCTAAGCCCGAGGCGACAGTGGCT
                      ____________________________________________________________
consensus ACTCAGAGTGCACTTGATGAGAGGGAAGTGTTGCCCCCTAAGCCCGAGGCGACAGTGGCT
 
. : . : . : . : . : . :
JMSF030B16- ACTACTTTAGCCGGAGCGTCCTCTGCCACCGCTCANGGCATTGAAATCGCGCTTGGATTT
rJMSF030B16+ ACTACTTTAGCCGGAGCGTCCTCTGCCACCGCTCATGGCATTGAAATCGCGCTTGGATTT
                      ____________________________________________________________
consensus ACTACTTTAGCCGGAGCGTCCTCTGCCACCGCTCATGGCATTGAAATCGCGCTTGGATTT
 
. : . : . : . : . : . :
JMSF030B16- AAGCCGGTTGAACACCCAACCGAGCCTCTTGAAACCGACAGCCCTATTCAATGTCCACTG
rJMSF030B16+ AAGCCGGTTGAACACCCAACCGAGCCTCTTGAAACCGACAGCCCTATTCAATGTCCACTG
                      ____________________________________________________________
consensus AAGCCGGTTGAACACCCAACCGAGCCTCTTGAAACCGACAGCCCTATTCAATGTCCACTG
 
. : . : . : . : . : . :
JMSF030B16- CCCGAACCTTCGATACTTA
rJMSF030B16+ CCCGAACCTTCGATACTTAATGATGGAAGAATATGGAAAGAGCGGGTTTCTGCTGTGCGA
                      ____________________________________________________________
consensus CCCGAACCTTCGATACTTAATGATGGAAGAATATGGAAAGAGCGGGTTTCTGCTGTGCGA
 
. : . : . : . : . : . :
rJMSF030B16+ AAAACAGCCGATTTGCCAGTTATGCAGCAAGGGGCAGCTGGAGAGCCAGAGGGAGCCGGC
                      ____________________________________________________________
consensus AAAACAGCCGATTTGCCAGTTATGCAGCAAGGGGCAGCTGGAGAGCCAGAGGGAGCCGGC
 
. : . : . : . : . : . :
rJMSF030B16+ ACAGCACGTAGACCCCCTTCCGGGCGCTTGATCCTTCCCTCGGTTAGTGCACCAGAACAT
                      ____________________________________________________________
consensus ACAGCACGTAGACCCCCTTCCGGGCGCTTGATCCTTCCCTCGGTTAGTGCACCAGAACAT
 
. : . : . : . : . : . :
rJMSF030B16+ AGTATCCTTAAACTGCTCGAAGAATCTGGGATTTAGCCGAACTCGCTGTTTTGTGCTGGA
                      ____________________________________________________________
consensus AGTATCCTTAAACTGCTCGAAGAATCTGGGATTTAGCCGAACTCGCTGTTTTGTGCTGGA
 
. : . : . : . : . : . :
rJMSF030B16+ ATTTCTTTCCCATACTTAGAACATATGCATGTTTTGTTATACTGCCTCAAGTCTGTTTCA
                      ____________________________________________________________
consensus ATTTCTTTCCCATACTTAGAACATATGCATGTTTTGTTATACTGCCTCAAGTCTGTTTCA
 
. : . : . : . : . : . :
rJMSF030B16+ TTTGTTTTGGCTGTTTTGTATAGGTATGTTATTATAATATATGCATGTAATATCTTAAAT
                      ____________________________________________________________
consensus TTTGTTTTGGCTGTTTTGTATAGGTATGTTATTATAATATATGCATGTAATATCTTAAAT