Previous Contig 012688:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001N14Sequence366018243gb:AY466010_16079709e-10Triticum turgidum subsp. durum putative ribokinase (7H8) gene, complete cds.724012688 (3)pir|F86328|F863282e-69F14P1.7 protein - Arabidopsis thaliana>gb:AE005172_890922 Arabidopsis thaliana c
JMSF030A16Sequence649012688 (3)pir|F86328|F863285e-83F14P1.7 protein - Arabidopsis thaliana>gb:AE005172_890922 Arabidopsis thaliana c731012688 (3)pir|F86328|F863281e-68F14P1.7 protein - Arabidopsis thaliana>gb:AE005172_890922 Arabidopsis thaliana c

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030A16- GCACGGAAAATCCTTCTCCGTTGAAGACCATAGCTGGAGGAAGTGTAGCAAATACT
                      ____________________________________________________________
consensus GCACGGAAAATCCTTCTCCGTTGAAGACCATAGCTGGAGGAAGTGTAGCAAATACT
 
. : . : . : . : . : . :
JMSF030A16- ATCAGAGGCTTGGCTGCTGGATTTGGGATTCAATGTGGAATAATTGGGGCCTACGGGAAT
                      ____________________________________________________________
consensus ATCAGAGGCTTGGCTGCTGGATTTGGGATTCAATGTGGAATAATTGGGGCCTACGGGAAT
 
. : . : . : . : . : . :
JMSF030A16- GATCAACAAGGAAAGTTATTCGTAAGTAACATGAGCTCTTACAAAGTGGATATCTCTCGG
                      ____________________________________________________________
consensus GATCAACAAGGAAAGTTATTCGTAAGTAACATGAGCTCTTACAAAGTGGATATCTCTCGG
 
. : . : . : . : . : . :
JMSF030A16- TTGAGGCTGAAGAATGGACACACAGCTCAGTGTGTCTGTCTGGTTGATGAACATGGCAAT
                      ____________________________________________________________
consensus TTGAGGCTGAAGAATGGACACACAGCTCAGTGTGTCTGTCTGGTTGATGAACATGGCAAT
 
. : . : . : . : . : . :
JMSF030A16- CGCACAATGCGTCCATGTCTTTCAAGCGCTGTGAAAGTTCAGGCAGATGAATTGAAAAGA
                      ____________________________________________________________
consensus CGCACAATGCGTCCATGTCTTTCAAGCGCTGTGAAAGTTCAGGCAGATGAATTGAAAAGA
 
. : . : . : . : . : . :
JMSF030A16- GAGGATTTCAAAGGATCAAAGTGGTTAGTGCTAAGATATGCAATACTAAACTTTGATGTT
                      ____________________________________________________________
consensus GAGGATTTCAAAGGATCAAAGTGGTTAGTGCTAAGATATGCAATACTAAACTTTGATGTT
 
. : . : . : . : . : . :
JMSF030A16- ATCAATGCGGCCGTTCAGATAGCCAAACAAGAAGGCCTCTGTATTTCGCTAGATCTGGCC
rJMSF001N14+ GCCAANCAAGAAGGCCTCTGTATTTCGCTAGATCTGGCC
rJMSF030A16+ TCGCTAGATCTGGCC
                      ____________________________________________________________
consensus ATCAATGCGGCCGTTCAGATAGCCAAACAAGAAGGCCTCTGTATTTCGCTAGATCTGGCC
 
. : . : . : . : . : . :
JMSF030A16- AGCTTTGAGATGGTGAGGGAGTTTAGGCAACCACTTATCCAGTTATTAGAGTCGGGGAAT
rJMSF001N14+ AGCTTTGAGATGGTGAGGGAGTTTAGGCAACCACTTATCCAGTTATTAGAGTCGGGGAAT
rJMSF030A16+ AGCTTNGAGATGGTGAGGGAGTTTAGGCAACCACTTATCCAGTTATTAGAGTCGGGGAAT
                      ____________________________________________________________
consensus AGCTTTGAGATGGTGAGGGAGTTTAGGCAACCACTTATCCAGTTATTAGAGTCGGGGAAT
 
. : . : . : . : . : . :
JMSF030A16- ATAGACCTTTGTTTCGCGAATGAGGATGAAGCGAAAGAGCTGCTAAGTAGTGAAGAAGAA
rJMSF001N14+ ATAGACCTTTGTTTCGCGAATGAGGATGAAGCGAAAGAGCTGCTAAGTAGTGAAGAAGAA
rJMSF030A16+ ATAGACCTTTGTTTCGCGAATGAGGATGAAGCGAAAGAGCTGCTAAGTAGTGAAGAAGAA
                      ____________________________________________________________
consensus ATAGACCTTTGTTTCGCGAATGAGGATGAAGCGAAAGAGCTGCTAAGTAGTGAAGAAGAA
 
. : . : . : . : . : . :
JMSF030A16- GATACAGATCCTGAGGTGGCACTTGAATTCATGGCCAAACACTGCCGGTGGGCAGTTGTA
rJMSF001N14+ GATACAGATCCTGAGGTGGCACTTGAATTCATGGCCAAACACTGCCGGTGGGCAGTTGTA
rJMSF030A16+ GATACAGATCCTGAGGTGGCACTTGAATTCATGGCCAAACACTGCCGGTGGGCAGTTGTA
                      ____________________________________________________________
consensus GATACAGATCCTGAGGTGGCACTTGAATTCATGGCCAAACACTGCCGGTGGGCAGTTGTA
 
. : . : . : . : . : . :
JMSF030A16- ACACTAGGCCAAAACGGATGCATTGCAAAACATGGAAATGAGGTTGTGCGGGT
rJMSF001N14+ ACACTAGGCCAAAACGGATGCATTGCAAAACATGGAAATGAGGTTGTGCGGGTTCCAGCA
rJMSF030A16+ ACACTAGGCCAAAACGGATGCATTGCAAAACATGGAAATGAGGTTGTGCGGGTTCCAGCA
                      ____________________________________________________________
consensus ACACTAGGCCAAAACGGATGCATTGCAAAACATGGAAATGAGGTTGTGCGGGTTCCAGCA
 
. : . : . : . : . : . :
rJMSF001N14+ ATAGGAGAGTCAAAGGCGAGCGATGCTACTGGGGCGGGAGACTTGTTCGCGAGTGGATTT
rJMSF030A16+ ATAGGAGAGTCAAAGGCGAGCGATGCTACTGGGGCGGGAGACTTGTTCGCGAGTGGATTT
                      ____________________________________________________________
consensus ATAGGAGAGTCAAAGGCGAGCGATGCTACTGGGGCGGGAGACTTGTTCGCGAGTGGATTT
 
. : . : . : . : . : . :
rJMSF001N14+ CTGTATGGGCTAATAAAGGATCTGTCTCTCGAAGATTGTTGTCGTGTGGGGTCGTGCAGT
rJMSF030A16+ CTGTATGGGCTAATAAAGGATCTGTCTCTCGAAGATTGTTGTCGTGTGGGGTCGTGCAGT
                      ____________________________________________________________
consensus CTGTATGGGCTAATAAAGGATCTGTCTCTCGAAGATTGTTGTCGTGTGGGGTCGTGCAGT
 
. : . : . : . : . : . :
rJMSF001N14+ GGGGGGTCTGTCATTCGAGCTCTCGGAGGTGAGGTGACACCTGCAAACTGGCAATGGATG
rJMSF030A16+ GGGGGGTCTGTCATTCGAGCTCTCGGAGGTGAGGTGACACCTGCAAACTGGCAATGGATG
                      ____________________________________________________________
consensus GGGGGGTCTGTCATTCGAGCTCTCGGAGGTGAGGTGACACCTGCAAACTGGCAATGGATG
 
. : . : . : . : . : . :
rJMSF001N14+ TACAAACAAATGCAGGCCAAGGGACTCTGCACCCCTCACCCCATCA
rJMSF030A16+ TACAAACAAATGCAGGCCAAGGGACTCTGCACCCCTCACCCCATCAATCATCAGAAGCTC
                      ____________________________________________________________
consensus TACAAACAAATGCAGGCCAAGGGACTCTGCACCCCTCACCCCATCAATCATCAGAAGCTC
 
. : . : . : . : . : . :
rJMSF030A16+ TTTTGAAACAGGAGAATCATAGGACATTTCTATGTTTTTATTAAGATGTTTGCATACCTA
                      ____________________________________________________________
consensus TTTTGAAACAGGAGAATCATAGGACATTTCTATGTTTTTATTAAGATGTTTGCATACCTA
 
. : . : . : . : . : . :
rJMSF030A16+ GTTCTCTTCTNTTCCAATCCCCCTCTCCACCCTCTTCCCCTCAAAAGAAAGGATTAGGAA
                      ____________________________________________________________
consensus GTTCTCTTCTNTTCCAATCCCCCTCTCCACCCTCTTCCCCTCAAAAGAAAGGATTAGGAA
 
. : . : . : . : . : . :
rJMSF030A16+ GAAGAAAATGAAAAACAATGAGGCTTTGTTTTTTCTGTGTTATCTTATGTTTGAACCTTG
                      ____________________________________________________________
consensus GAAGAAAATGAAAAACAATGAGGCTTTGTTTTTTCTGTGTTATCTTATGTTTGAACCTTG