Previous Contig 012683:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014K16Sequence446012683 (5)gb:AY051042_15625181e-66Arabidopsis thaliana unknown protein (At1g70570) mRNA, complete cds.>gb:AF360286770022622gb:AP004269_18395073e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P004
JMSF016I04Sequence238012683 (5)gb:AY051042_15625181e-31Arabidopsis thaliana unknown protein (At1g70570) mRNA, complete cds.>gb:AF360286748012683 (5)gb:AY051042_15625183e-74Arabidopsis thaliana unknown protein (At1g70570) mRNA, complete cds.>gb:AF360286
JMSF029P23Sequence625006636 (2)gb:AY051042_15625182e-46Arabidopsis thaliana unknown protein (At1g70570) mRNA, complete cds.>gb:AF360286631012683 (5)gb:AY051042_15625182e-52Arabidopsis thaliana unknown protein (At1g70570) mRNA, complete cds.>gb:AF360286
JMSF034F09Sequence661006636 (2)gb:AY051042_15625181e-52Arabidopsis thaliana unknown protein (At1g70570) mRNA, complete cds.>gb:AF360286744012683 (5)gb:AY051042_15625182e-72Arabidopsis thaliana unknown protein (At1g70570) mRNA, complete cds.>gb:AF360286

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014K16+ CCTGCACCTGTTGCTGATGTTAACTCACTCACCCATTAC
                      ____________________________________________________________
consensus CCTGCACCTGTTGCTGATGTTAACTCACTCACCCATTAC
 
. : . : . : . : . : . :
JMSF014K16+ GGTGAACCTTATGATGGAAACACCCGCTATTTCAGAAGCACACTATTTGTTGCTGCTGTT
                      ____________________________________________________________
consensus GGTGAACCTTATGATGGAAACACCCGCTATTTCAGAAGCACACTATTTGTTGCTGCTGTT
 
. : . : . : . : . : . :
JMSF014K16+ AGATCNTGCTATGGTGAATCTTGCTTGCTCCATGGTGTGGATTGGATGCCACCAAAGGGT
                      ____________________________________________________________
consensus AGATCNTGCTATGGTGAATCTTGCTTGCTCCATGGTGTGGATTGGATGCCACCAAAGGGT
 
. : . : . : . : . : . :
JMSF014K16+ GGTGTCACTGAAGAACAAATGCTGAAGTTCATGGGTGCATATACCCAGTTATCACCATTG
                      ____________________________________________________________
consensus GGTGTCACTGAAGAACAAATGCTGAAGTTCATGGGTGCATATACCCAGTTATCACCATTG
 
. : . : . : . : . : . :
JMSF014K16+ CAAGCCAAAAAGCTTCTCGAGGACGACAAGGTTGGTTTTGCTTACGTAAGTCAGCGTGAA
JMSF016I04- ACGACAAGGTTGGTTTTGCTTACGTAAGTCAGCGTGAA
                      ____________________________________________________________
consensus CAAGCCAAAAAGCTTCTCGAGGACGACAAGGTTGGTTTTGCTTACGTAAGTCAGCGTGAA
 
. : . : . : . : . : . :
JMSF014K16+ GCCCGTCCATCTTTACATTCTTTAGTTGGATTGAGGGAACATATAAAGAAGCGCCCACCA
JMSF016I04- GCCCGTCCATCTTTACATTCTTTAGTTGGATTGAGGGAACATATAAAGAAGCGCCCACCA
                      ____________________________________________________________
consensus GCCCGTCCATCTTTACATTCTTTAGTTGGATTGAGGGAACATATAAAGAAGCGCCCACCA
 
. : . : . : . : . : . :
JMSF014K16+ TTGGCAACTTCAGAAAAGGTTCAACAAATTGTAAGGGCACAAGGAAAGGAAGCAATTGTT
JMSF016I04- TTGGCAACTTCAGAAAAGGTTCAACAAATTGTAAGGGCACAAGGAAAGGAAGCAATTGTT
rJMSF034F09+ GGCACAAGG-AAGGAAGCAATTGNT
rJMSF016I04+ GGCACAAGGAAAGGAAGCAATTGTT
                      ____________________________________________________________
consensus TTGGCAACTTCAGAAAAGGTTCAACAAATTGTAAGGGCACAAGGAAAGGAAGCAATTGTT
 
. : . : . : . : . : . :
JMSF014K16+ GCCAGCTTTTATCATGAAGGTTATGAAGAGCCACTACTAATGCTTAT
JMSF016I04- GCCAGCTTTTATCATGAAGGTTATGAAGAGCCACTACTAATGCTTATGAGAAGGAGAGGT
rJMSF034F09+ GCCAGCTTTTATCATGAAGGTTATGAAGAGCCACTACTAATGCTTATGAGAAGGAGAGGT
rJMSF016I04+ GCCAGCTTTTATCATGAAGGTTATGAAGAGCCACTACTAATGCTTATGAGAAGGAGAGGT
                      ____________________________________________________________
consensus GCCAGCTTTTATCATGAAGGTTATGAAGAGCCACTACTAATGCTTATGAGAAGGAGAGGT
 
. : . : . : . : . : . :
JMSF016I04- GTTCATTCTGGTTTAGTGGT
rJMSF034F09+ GTTCATTCTGGTTTAGTGGTGAAGGGAGAGGAAGGTGCACTGTCAATGACCACTAAATCA
rJMSF016I04+ GTTCATTCTGGTTTAGTGGTGAAGGGAGAGGAAGGTGCACTGTCAATGACCACTAAATCA
rJMSF029P23+ GGAAGGTGCACTGTCAATGACCACTAAATCA
                      ____________________________________________________________
consensus GTTCATTCTGGTTTAGTGGTGAAGGGAGAGGAAGGTGCACTGTCAATGACCACTAAATCA
 
. : . : . : . : . : . :
rJMSF034F09+ CGATCAGTAAATGCATCAAAGGGTTTACCGGTGAATTACTGTTCAGGATTTCGTTCAGCA
rJMSF016I04+ CGATCAGTAAATGCATCAAAGGGTTTACCGGTGAATTACTGTTCAGGATTTCGTTCAGCA
rJMSF029P23+ CGATCAGTAAATGCATCAAAGGGTTTACCGGTGAATTACTGTTCAGGATTTCGTTCAGCA
                      ____________________________________________________________
consensus CGATCAGTAAATGCATCAAAGGGTTTACCGGTGAATTACTGTTCAGGATTTCGTTCAGCA
 
. : . : . : . : . : . :
rJMSF034F09+ AATAGGACACCTGCTAATGTAGCTGATGGTGTATCACGTGAGAGTTTTAAATTTGTGGTG
rJMSF016I04+ AATAGGACACCTGCTAATGTAGCTGATGGTGTATCACGTGAGAGTTTTAAATTTGTGGTG
rJMSF029P23+ AATAGGACACCTGCTAATGTAGCTGATGGTGTATCACGTGAGAGTTTTAAATTTGTGGTG
                      ____________________________________________________________
consensus AATAGGACACCTGCTAATGTAGCTGATGGTGTATCACGTGAGAGTTTTAAATTTGTGGTG
 
. : . : . : . : . : . :
rJMSF034F09+ AACGCAGAGAATTATGGCTTTGAACCCACTGATACTCCAAGAACTGATAGATCGGTTGCA
rJMSF016I04+ AACGCAGAGAATTATGGCTTTGAACCCACTGATACTCCAAGAACTGATAGATCGGTTGCA
rJMSF029P23+ AACGCAGAGAATTATGGCTTTGAACCCACTGATACTCCAAGAACTGATAGATCGGTTGCA
                      ____________________________________________________________
consensus AACGCAGAGAATTATGGCTTTGAACCCACTGATACTCCAAGAACTGATAGATCGGTTGCA
 
. : . : . : . : . : . :
rJMSF034F09+ AGGAATGTAGAACTGGGTTTAGCTGCTTTACGAGGTGAGAAAGGTCCAGCATATGATCGA
rJMSF016I04+ AGGAATGTAGAACTGGGTTTAGCTGCTTTACGAGGTGAGAAAGGTCCAGCATATGATCGA
rJMSF029P23+ AGGAATGTAGAACTGGGTTTAGCTGCTTTACGAGGTGAGAAAGGTCCAGCATATGATCGA
                      ____________________________________________________________
consensus AGGAATGTAGAACTGGGTTTAGCTGCTTTACGAGGTGAGAAAGGTCCAGCATATGATCGA
 
. : . : . : . : . : . :
rJMSF034F09+ ATCGTCTTGAATGCTGGAATGGTTGACCATTTCCTTGGATGTGAAGGTGCCGAAGACATG
rJMSF016I04+ ATCGTCTTGAATGCTGGAATGGTTGACCATTTCCTTGGATGTGAAGGTGCCGAAGACATG
rJMSF029P23+ ATCGTCTTGAATGCTGGAATGGTTGACCATTTCCTTGGATGTGAAGGTGCCGAAGACATG
                      ____________________________________________________________
consensus ATCGTCTTGAATGCTGGAATGGTTGACCATTTCCTTGGATGTGAAGGTGCCGAAGACATG
 
. : . : . : . : . : . :
rJMSF034F09+ TCTGCAGCCCTGGATAGAGCAAGAGAGGCCATAGATAGCGGTAATGCCTTAAAGCGACTC
rJMSF016I04+ TCTGCAGCCCTGGATAGAGCAAGAGAGGCCATAGATAGCGGTAATGCCTTAAAGCGACTC
rJMSF029P23+ TCTGCAGCCCTGGATAGAGCAAGAGAGGCCATAGATAGCGGTAATGCCTTAAAGCGACTC
                      ____________________________________________________________
consensus TCTGCAGCCCTGGATAGAGCAAGAGAGGCCATAGATAGCGGTAATGCCTTAAAGCGACTC
 
. : . : . : . : . : . :
rJMSF034F09+ TTGAGGTACATACAGATATCTAATAGAGTGCGATGAAAGTTGATGCATACAGTGGTGAAC
rJMSF016I04+ TTGAGGTACATACAGATATCTAATAGAGTGCGATGAAAGTTGATGCATACAGTGGTGAAC
rJMSF029P23+ TTGAGGTACATACAGATATCTAATAGAGTGCGATGAAAGTTGATGCATACAGTGGTGAAC
                      ____________________________________________________________
consensus TTGAGGTACATACAGATATCTAATAGAGTGCGATGAAAGTTGATGCATACAGTGGTGAAC
 
. : . : . : . : . : . :
rJMSF034F09+ ATTCTTCCGGTTTTTTGCTGCACCTTATGTTCCATTCATAAACCATGTACACTTTGTTTC
rJMSF016I04+ ATTCTTCCGGTTTTTTGCTGCACCTTATGTTCCATTCATAAACCATGTACACTTTGTTTC
rJMSF029P23+ ATTCTTCCGGTTTTTTGCTGCACCTTATGTTCCATTCATAAACCATGTACACTTTGTTTC
                      ____________________________________________________________
consensus ATTCTTCCGGTTTTTTGCTGCACCTTATGTTCCATTCATAAACCATGTACACTTTGTTTC
 
. : . : . : . : . : . :
rJMSF034F09+ ACAACTATGAAAATGAGAAAATCATAGTTACATATTTTGTTTTTTTTGTAAAGTAGGTTC
rJMSF016I04+ ACAACTATGAAAATGAGAAAATCATAGTTACATATTTTGTTTTTTTTGTAAAGTAGGTTC
rJMSF029P23+ ACAACTATGAAAATGAGAAAATCATAGTTACATATTTTGTTTTTTTTGTAAAGTAGGTTC
                      ____________________________________________________________
consensus ACAACTATGAAAATGAGAAAATCATAGTTACATATTTTGTTTTTTTTGTAAAGTAGGTTC
 
. : . : . : . : . : . :
rJMSF034F09+ TCTCCACTTTGTTGTCAACCTACAAACACGTTTCTGAGTTTT
rJMSF016I04+ TCTCCACTTTGTTGTCAACCTACAAACACGTTTCTGAGTTTT
rJMSF029P23+ TCTCCACTTTGTTGTCAACCTACAAACACGTTTCTGAGTTTTGACCAAAGATGTAAGTGT
                      ____________________________________________________________
consensus TCTCCACTTTGTTGTCAACCTACAAACACGTTTCTGAGTTTTGACCAAAGATGTAAGTGT