Previous Contig 012680:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029P01Sequence580012680 (4)gb:BT005633_16385734e-19Arabidopsis thaliana clone U51297 unknown protein (At3g21400) mRNA, complete cds741012680 (4)gb:BT005633_16385733e-39Arabidopsis thaliana clone U51297 unknown protein (At3g21400) mRNA, complete cds
JMSF046E20Sequence704012680 (4)gb:BT005633_16385738e-40Arabidopsis thaliana clone U51297 unknown protein (At3g21400) mRNA, complete cds654012680 (4)gb:BT005633_16385737e-40Arabidopsis thaliana clone U51297 unknown protein (At3g21400) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029P01- GGCGTGGA
                      ____________________________________________________________
consensus GGCGTGGA
 
. : . : . : . : . : . :
JMSF029P01- GAAGTATTGTATCTGTCGTTCTTTGTTGAAGCACCTTCTTCACTTTGAGATTTTCGCAAC
                      ____________________________________________________________
consensus GAAGTATTGTATCTGTCGTTCTTTGTTGAAGCACCTTCTTCACTTTGAGATTTTCGCAAC
 
. : . : . : . : . : . :
JMSF029P01- TAATTTTCTGCAAAAACAATTTTGAAAAAAAGCACAGAAATAGAAAATAATCCATCTTCG
                      ____________________________________________________________
consensus TAATTTTCTGCAAAAACAATTTTGAAAAAAAGCACAGAAATAGAAAATAATCCATCTTCG
 
. : . : . : . : . : . :
JMSF029P01- TTTGGTATTGAAGAAAATGCAACATTAAGATTCAAGGCTAGGAGTATAATTATAGTAGTG
                      ____________________________________________________________
consensus TTTGGTATTGAAGAAAATGCAACATTAAGATTCAAGGCTAGGAGTATAATTATAGTAGTG
 
. : . : . : . : . : . :
JMSF029P01- CATACATACGAATTGGAATATATAGATTATTACAGAGAGAGAAAGGGAGCAGATGGGGCA
rJMSF046E20+ GGGGCA
JMSF046E20- GGGGCA
                      ____________________________________________________________
consensus CATACATACGAATTGGAATATATAGATTATTACAGAGAGAGAAAGGGAGCAGATGGGGCA
 
. : . : . : . : . : . :
JMSF029P01- GGCATTTCGTCGAGCAGCTGGAAGGATCGGAAGCTCCGGAATGGAAACTTCGTCGTCGCA
rJMSF046E20+ GGCATTTCGTCGAGCAGCTGGAAGGATCGGAAGCTCCGGAATGGAAACTTCGTCGTCGCA
JMSF046E20- GGCATTTCGTCGAGCAGCTGGAAGGATCGGAAGCTCCGGAATGGAAACTTCGTCGTCGCA
rJMSF029P01+ GAATGGAAACTTCGTCGTCGCA
                      ____________________________________________________________
consensus GGCATTTCGTCGAGCAGCTGGAAGGATCGGAAGCTCCGGAATGGAAACTTCGTCGTCGCA
 
. : . : . : . : . : . :
JMSF029P01- GCTGAAGAAGCCCATTGAGAGACCGCCACCCCCGCCGCCGGAAATTATATCCGCCCAAAA
rJMSF046E20+ GCTGAAGAAGCCCATTGAGAGACCGCCACCCCCGCCGCCGGAAATTATATCCGCCCAAAA
JMSF046E20- GCTGAAGAAGCCCATTGAGAGACCGCCACCCCCGCCGCCGGAAATTATATCCGCCCAAAA
rJMSF029P01+ GCTGAAGAAGCCCA-TGAGAGACCGCCACCCCCGCCGCCGGAAATTATATCCGCCCAAAA
                      ____________________________________________________________
consensus GCTGAAGAAGCCCATTGAGAGACCGCCACCCCCGCCGCCGGAAATTATATCCGCCCAAAA
 
. : . : . : . : . : . :
JMSF029P01- TGTCGGCACCGGAGCTGAGAGCACTCCAAAAGTTAATCCCAAAAGTGTCCTTGAAGAACG
rJMSF046E20+ TGTCGGCACCGGAGCTGAGAGCACTCCAAAAGTTAATCCCAAAAGTGTCCTTGAAGAACG
JMSF046E20- TGTCGGCACCGGAGCTGAGAGCACTCCAAAAGTTAATCCCAAAAGTGTCCTTGAAGAACG
rJMSF029P01+ TGTCGGCACCGGAGCTGAGAGCACTCCAAAAGTTAATCCCAAAAGTGTCCTTGAAGAACG
                      ____________________________________________________________
consensus TGTCGGCACCGGAGCTGAGAGCACTCCAAAAGTTAATCCCAAAAGTGTCCTTGAAGAACG
 
. : . : . : . : . : . :
JMSF029P01- TGATCCACAGTTTGATGTGATGCTTAGTCAAATGGTTGGTAGAATCCGTGCTAAGCCTGG
rJMSF046E20+ TGATCCACAGTTTGATGTGATGCTTAGTCAAATGGTTGGTAGAATCCGTGCTAAGCCTGG
JMSF046E20- TGATCCACAGTTTGATGTGATGCTTAGTCAAATGGTTGGTAGAATCCGTGCTAAGCCTGG
rJMSF029P01+ TGATCCACAGTTTGATGTGATGCTTAGTCAAATGGTTGGTAGAATCCGTGCTAAGCCTGG
                      ____________________________________________________________
consensus TGATCCACAGTTTGATGTGATGCTTAGTCAAATGGTTGGTAGAATCCGTGCTAAGCCTGG
 
. : . : . : . : . : . :
JMSF029P01- AGGGAAACTTGAAATGGGTGAGGGATCGGTTGTGGAAAACTATGATAGGCCTTTACCAAA
rJMSF046E20+ AGGGAAACTTGAAATGGGTGAGGGATCGGTTGTGGAAAACTATGATAGGCCTTTACCAAA
JMSF046E20- AGGGAAACTTGAAATGGGTGAGGGATCGGTTGTGGAAAACTATGATAGGCCTTTACCAAA
rJMSF029P01+ AGGGAAACTTGAAATGGGTGAGGGATCGGTTGTGGAAAACTATGATAGGCCTTTACCAAA
                      ____________________________________________________________
consensus AGGGAAACTTGAAATGGGTGAGGGATCGGTTGTGGAAAACTATGATAGGCCTTTACCAAA
 
. : . : . : . : . : . :
JMSF029P01- GCTAAGGAATACAACAACAGAGTCTAGCAGAT
rJMSF046E20+ GCTAAGGAATACAACAACAAAGTCTAGCAGATACGAGGGAAGGCCGGCGCCTCCAGGAAC
JMSF046E20- GCTAAGGAATACAACAACAAAGTCTAGCAGATACGAGGGAAGGCCGGCGCCTCCAGGAAC
rJMSF029P01+ GCTAAGGAATACAACAACAGAGTCTAGCAGATACGAGGGAAGGCCGGCGCCTCCAGGAAC
                      ____________________________________________________________
consensus GCTAAGGAATACAACAACAGAGTCTAGCAGATACGAGGGAAGGCCGGCGCCTCCAGGAAC
 
. : . : . : . : . : . :
rJMSF046E20+ CTTAAACGTAGCGCAGTTACGACAAATCATAGTGTTGTATCAAGGCAAATCAGATGAGCA
JMSF046E20- CTTAAACGTAGCGCAGTTACGACAAATCATAGTGTTGTATCAAGGCAAATCAGATGAGCA
rJMSF029P01+ CTTAAACGTAGCGCAGTTACGACAAATCATAGTGTTGTATCAAGGCAAATCAGATGAGCA
                      ____________________________________________________________
consensus CTTAAACGTAGCGCAGTTACGACAAATCATAGTGTTGTATCAAGGCAAATCAGATGAGCA
 
. : . : . : . : . : . :
rJMSF046E20+ TGAAGGGCCTATGGATGTCAACCAAATAGCTAACAAGTTCCGAATCGACGTTTCTCAAGT
JMSF046E20- TGAAGGGCCTATGGATGTCAACCAAATAGCTAACAAGTTCCGAATCGACGTTTCTCAAGT
rJMSF029P01+ TGAAGGGCCTATGGATGTCAACCAAATAGCTAACAAGTTCCGAATCGACGTTTCTCAAGT
                      ____________________________________________________________
consensus TGAAGGGCCTATGGATGTCAACCAAATAGCTAACAAGTTCCGAATCGACGTTTCTCAAGT
 
. : . : . : . : . : . :
rJMSF046E20+ CCAAAGCATCGTCCAGTTTGTGTCACTGCCTCCTGAGGACACCAAAGAGCAGAAGAAGTT
JMSF046E20- CCAAAGCATCGTCCAGTTTGTGTCACTGCCTCCTGAGGACACCAAAGAGCAGAAGAAGTT
rJMSF029P01+ CCAAAGCATCGTCCAGTTTGTGTCACTGCCTCCTGAGGACACCAAAGAGCAGAAGAAGTT
                      ____________________________________________________________
consensus CCAAAGCATCGTCCAGTTTGTGTCACTGCCTCCTGAGGACACCAAAGAGCAGAAGAAGTT
 
. : . : . : . : . : . :
rJMSF046E20+ CTGATTTAGTTTTTGCAAAATACTCTCATCACAATTTTGCAATCAGAGATCACATTGTTA
JMSF046E20- CTGATTTAGTTTTTGCAAAATACTCTCATCACAATTTTGCAATCAGAGATCACATTGTTA
rJMSF029P01+ CTGATTTAGTTTTTGCAAAATACTCTCATCACAATTTTGCAATCAGAGATCACATTGTTA
                      ____________________________________________________________
consensus CTGATTTAGTTTTTGCAAAATACTCTCATCACAATTTTGCAATCAGAGATCACATTGTTA
 
. : . : . : . : . : . :
rJMSF046E20+ CTAATAATCACAAAGCTTTTAGTGTATGTGAACACTAAC
JMSF046E20- CTAATAATCACAAAGCTTTTAGTGTATGTGAACACTAACACTGTTTTGACTTTATATTAA
rJMSF029P01+ CTAATAATCACAAAGCTTTTAGTGTATGTGAACACTAACACTGTTTTGACTTTATATTAA
                      ____________________________________________________________
consensus CTAATAATCACAAAGCTTTTAGTGTATGTGAACACTAACACTGTTTTGACTTTATATTAA
 
. : . : . : . : . : . :
JMSF046E20- TGCAAATGAGTCTAGTGTTTGTGGATTA
rJMSF029P01+ TGCAAATGAGTCTAGTGTTTGTGGATTATGTATTACTAGTAATACTCTCAGGTCTTGTAA
                      ____________________________________________________________
consensus TGCAAATGAGTCTAGTGTTTGTGGATTATGTATTACTAGTAATACTCTCAGGTCTTGTAA
 
. : . : . : . : . : . :
rJMSF029P01+ TCCAATCTTGATCCTTCCCCCCAGTTGATTCACCAAGAATGGTGAAAATGGCAAATATTT
                      ____________________________________________________________
consensus TCCAATCTTGATCCTTCCCCCCAGTTGATTCACCAAGAATGGTGAAAATGGCAAATATTT