Previous Contig 012675:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020K01Sequence714005912 (3)gb:AY049264_15619062e-49Arabidopsis thaliana At2g44640/F16B22.13 mRNA, complete cds.>gb:AY090281_1574033778012675 (3)gb:AC003672_15311302e-58Arabidopsis thaliana chromosome 2 clone F16B22 map m336, complete sequence.
JMSF029O05Sequence693005912 (3)gb:AY049264_15619062e-47Arabidopsis thaliana At2g44640/F16B22.13 mRNA, complete cds.>gb:AY090281_1574033719012675 (3)gb:AC003672_15311308e-49Arabidopsis thaliana chromosome 2 clone F16B22 map m336, complete sequence.
JMSF032F16Sequence665005912 (3)gb:AY049264_15619061e-49Arabidopsis thaliana At2g44640/F16B22.13 mRNA, complete cds.>gb:AY090281_1574033794012675 (3)gb:AC003672_15311301e-58Arabidopsis thaliana chromosome 2 clone F16B22 map m336, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020K01+ GA
rJMSF032F16+ CAGTTGATAACAGTGA
                      ____________________________________________________________
consensus CAGTTGATAACAGTGA
 
. : . : . : . : . : . :
rJMSF020K01+ TGATGCAGTGCATCCTGCTCTGATGCCAGGACTATGCGCAAAAGGTGCCGTTTCGTATGA
rJMSF032F16+ TGATGCAGTGCATCCTGCTCTGATGCCAGGACTATGCGCAAAAGGTGCCGTTTCGTATGA
                      ____________________________________________________________
consensus TGATGCAGTGCATCCTGCTCTGATGCCAGGACTATGCGCAAAAGGTGCCGTTTCGTATGA
 
. : . : . : . : . : . :
rJMSF020K01+ GAAGCATAAAGACCTCTGGAGAGAGGTGGAGAGAGAAAAGGATGTCATGATACGGACAGA
rJMSF032F16+ GAAGCATAAAGACCTCTGGAGAGAGGTGGAGAGAGAAAAGGATGTCATGATACGGACAGA
                      ____________________________________________________________
consensus GAAGCATAAAGACCTCTGGAGAGAGGTGGAGAGAGAAAAGGATGTCATGATACGGACAGA
 
. : . : . : . : . : . :
rJMSF020K01+ GAAAGGACTGTATTTCAGACCTGCTTATGATGTTCGTCTAAGGGAGCCTCATGCAAAAAT
rJMSF032F16+ GAAAGGACTGTATTTCAGACCTGCTTATGATGTTCGTCTAAGGGAGCCTCATGCAAAAAT
rJMSF029O05+ GGACTGTATTTCAGACCTGCTTATGATGTTCGTCTAAGGGAGCCTCATGCAAAAAT
                      ____________________________________________________________
consensus GAAAGGACTGTATTTCAGACCTGCTTATGATGTTCGTCTAAGGGAGCCTCATGCAAAAAT
 
. : . : . : . : . : . :
rJMSF020K01+ ATCTGGAATTATTGGTGGAACTTTTGCTGCTTGGGTTGGTGGTGGAAATAACTCTCTCAT
rJMSF032F16+ ATCTGGAATTATTGGTGGAACTTTTGCTGCTTGGGTTGGTGGTGGAAATAACTCTCTCAT
rJMSF029O05+ ATCTGGAATTATTGGTGGAACTTTTGCTGCTTGGGTTGGTGGTGGAAATAACTCTCTCAT
                      ____________________________________________________________
consensus ATCTGGAATTATTGGTGGAACTTTTGCTGCTTGGGTTGGTGGTGGAAATAACTCTCTCAT
 
. : . : . : . : . : . :
rJMSF020K01+ TACAGAGTCAAGGGAGGATAGAGAGAACACTCCTTACTCTAGGAGGCGCCCCTTAGGTGT
rJMSF032F16+ TACAGAGTCAAGGGAGGATAGAGAGAACACTCCTTACTCTAGGAGGCGCCCCTTAGGTGT
rJMSF029O05+ TACAGAGTCAAGGGAGGATAGAGAGAACACTCCTTACTCTAGGAGGCGCCCCTTAGGTGT
                      ____________________________________________________________
consensus TACAGAGTCAAGGGAGGATAGAGAGAACACTCCTTACTCTAGGAGGCGCCCCTTAGGTGT
 
. : . : . : . : . : . :
rJMSF020K01+ TGATTTATTTGGCTCATTTTGCTACACTCTCCAGCATGGCAAATTCAGAAAGCGATATAA
rJMSF032F16+ TGATTTATTTGGCTCATTTTGCTACACTCTCCAGCATGGCAAATTCAGAAAGCGATATAA
rJMSF029O05+ TGATTTATTTGGCTCATTTTGCTACACTCTCCAGCATGGCAAATTCAGAAAGCGATATAA
                      ____________________________________________________________
consensus TGATTTATTTGGCTCATTTTGCTACACTCTCCAGCATGGCAAATTCAGAAAGCGATATAA
 
. : . : . : . : . : . :
rJMSF020K01+ CGACCTCACCAGAATAGATGCTCGCTTGGACGTCTCTTCTGCTGTAGCAATAGCCAAACG
rJMSF032F16+ CGACCTCACCAGAATAGATGCTCGCTTGGACGTCTCTTCTGCTGTAGCAATAGCCAAACG
rJMSF029O05+ CGACCTCACCAGAATAGATGCTCGCTTGGACGTCTCTTCTGCTGTAGCAATAGCCAAACG
                      ____________________________________________________________
consensus CGACCTCACCAGAATAGATGCTCGCTTGGACGTCTCTTCTGCTGTAGCAATAGCCAAACG
 
. : . : . : . : . : . :
rJMSF020K01+ GGTTTCAAGAATTTTCAGAAGTGCTTCCAACACAAGAGATTCACTGTCTACCCCCAGGCT
rJMSF032F16+ GGTTTCAAGAATTTTCAGAAGTGCTTCCAACACAAGAGATTCACTGTCTACCCCCAGGCT
rJMSF029O05+ GGTTTCAAGAATTTTCAGAAGTGCTTCCAACACAAGAGATTCACTGTCTACCCCCAGGCT
                      ____________________________________________________________
consensus GGTTTCAAGAATTTTCAGAAGTGCTTCCAACACAAGAGATTCACTGTCTACCCCCAGGCT
 
. : . : . : . : . : . :
rJMSF020K01+ GAACTTGATCTTTCAGCAGCAGGTTGCTGGACCAATCGTGTTTCGATTAGACTCAAGGTT
rJMSF032F16+ GAACTTGATCTTTCAGCAGCAGGTTGCTGGACCAATCGTGTTTCGATTAGACTCAAGGTT
rJMSF029O05+ GAACTTGATCTTTCAGCAGCAGGTTGCTGGACCAATCGTGTTTCGATTAGACTCAAGGTT
                      ____________________________________________________________
consensus GAACTTGATCTTTCAGCAGCAGGTTGCTGGACCAATCGTGTTTCGATTAGACTCAAGGTT
 
. : . : . : . : . : . :
rJMSF020K01+ TTGTATTGATTCAATATATGGGGTACCTGTCCCAAAATTAGAAGATTATGTGCTTAGCTT
rJMSF032F16+ TTGTATTGATTCAATATATGGGGTACCTGTCCCAAAATTAGAAGATTATGTGCTTAGCTT
rJMSF029O05+ TTGTATTGATTCAATATATGGGGTACCTGTCCCAAAATTAGAAGATTATGTGCTTAGCTT
                      ____________________________________________________________
consensus TTGTATTGATTCAATATATGGGGTACCTGTCCCAAAATTAGAAGATTATGTGCTTAGCTT
 
. : . : . : . : . : . :
rJMSF020K01+ GAACTACTCTCTTAGACTACTGCATTCTGGGAAAGTGGTGGCATGGTATTCTCCTAAGAG
rJMSF032F16+ GAACTACTCTCTTAGACTACTGCATTCTGGGAAAGTGGTGGCATGGTATTCTCCTAAGAG
rJMSF029O05+ GAACTACTCTCTTAGACTACTGCATTCTGGGAAAGTGGTGGCATGGTATTCTCCTAAGAG
                      ____________________________________________________________
consensus GAACTACTCTCTTAGACTACTGCATTCTGGGAAAGTGGTGGCATGGTATTCTCCTAAGAG
 
. : . : . : . : . : . :
rJMSF020K01+ GAAAGAGGCCATGGTTGAGTTGCGGCTATTTGAGTTTTGAAAATCTACTTCTTGTTTAAC
rJMSF032F16+ GAAAGAGGCCATGGTTGAGTTGCGGCTATTTGAGTTTTGAAAATCTACTTCTTGTTTAAC
rJMSF029O05+ GAAAGAGGCCATGGTTGAGTTGCGGCTATTTGAGTTTTGAAAATCTACTTCTTGTTTAAC
                      ____________________________________________________________
consensus GAAAGAGGCCATGGTTGAGTTGCGGCTATTTGAGTTTTGAAAATCTACTTCTTGTTTAAC
 
. : . : . : . : . : . :
rJMSF020K01+ TACTTTTTTGTAGTTAGGGTGGTTATGTTCGTTTGTATGCAAGCAATTCTATTGCC
rJMSF032F16+ TACTTTTTTGTAGTTAGGGTGGTTATGTTCGTTTGTATGCAAGCAATTCTATTGCC
rJMSF029O05+ TACTTTTTTGTAGTTAGGGTGGTTATGTTCGTTTGTATGCAAGCAATTCTATTGCCTGTG
                      ____________________________________________________________
consensus TACTTTTTTGTAGTTAGGGTGGTTATGTTCGTTTGTATGCAAGCAATTCTATTGCCTGTG
 
. : . : . : . : . : . :
rJMSF029O05+ ACTTTCACAAGGCTTAATCTTACCATGAAGCTCTTTAAATACTCCCATTCTTTCGGTCTT
                      ____________________________________________________________
consensus ACTTTCACAAGGCTTAATCTTACCATGAAGCTCTTTAAATACTCCCATTCTTTCGGTCTT