Previous Contig 012647:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012A22Sequence440012647 (8)gb:AF061852_17652671e-22Arabidopsis thaliana iron superoxide dismutase 3 (FSD3) mRNA, partial cds.776012647 (8)gb:AB007648_15102073e-85Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKD15.>gb:AY065458_1566
JMSF029G15Sequence508012647 (8)gb:AF061852_17652673e-47Arabidopsis thaliana iron superoxide dismutase 3 (FSD3) mRNA, partial cds.808012647 (8)gb:AB007648_15102072e-82Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKD15.>gb:AY065458_1566
JMSF038J04Sequence666012647 (8)gb:AF061852_17652673e-67Arabidopsis thaliana iron superoxide dismutase 3 (FSD3) mRNA, partial cds.849012647 (8)gb:AB007648_15102074e-98Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKD15.>gb:AY065458_1566
JMSF049A14Sequence678012647 (8)gb:AF061852_17652673e-64Arabidopsis thaliana iron superoxide dismutase 3 (FSD3) mRNA, partial cds.758012647 (8)gb:AB007648_15102072e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKD15.>gb:AY065458_1566

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012A22- GAATGACTAAAGTTGCCTCCCCGT
JMSF049A14- GACTAAAGTTGCCTCCCCGT
                      ____________________________________________________________
consensus GAATGACTAAAGTTGCCTCCCCGT
 
. : . : . : . : . : . :
JMSF012A22- TATCGCTTTACAAGCAAAAAGAAGAAAGCTTTGAAAGATCCAGTTCCAGAAATATCTTCT
JMSF049A14- TATCGCTTTACAAGCAAAAAGAAGAAAGCTTTGAAAGATCCAGTTCCAGAAATATCTTCT
JMSF029G15- AGAAATATCTTCT
JMSF038J04- ACAAGCAAAAAGAAGAAAGCTTTGAAAGATCCAGTTCCAGAAATATCTTCT
                      ____________________________________________________________
consensus TATCGCTTTACAAGCAAAAAGAAGAAAGCTTTGAAAGATCCAGTTCCAGAAATATCTTCT
 
. : . : . : . : . : . :
JMSF012A22- ATTTTTAAGCGTCAAGGGAGAGACATGAGTTGGTGTTCCCTTTCTACTACTACTTCAAGC
JMSF049A14- ATTTTTAAGCGTCAAGGGAGAGACATGAGTTGGTGTTCCCTTTCTACTACTACTTCAAGC
JMSF029G15- ATTTTTAAGCGTCAAGGGAGAGACATGAGTTGGTGTTCCCTTTCTACTACTACTTCAAGC
JMSF038J04- ATTTTTAAGCGTCAAGGGAGAGACATGAGTTGGTGTTCCCTTTCTACTACTACTTCAAGC
                      ____________________________________________________________
consensus ATTTTTAAGCGTCAAGGGAGAGACATGAGTTGGTGTTCCCTTTCTACTACTACTTCAAGC
 
. : . : . : . : . : . :
JMSF012A22- TCTATGATTCTTGACACTTCCAATGCGCCATTGAAGCAATTAAAGAGCTGGGGCAAAATT
JMSF049A14- TCTATGATTCTTGACACTTCCAATGCGCCATTGAAGCAATTAAAGAGCTGGGGCAAAATT
JMSF029G15- TCTATGATTCTTGACACTTCCAATGCGCCATTGAAGCAATTAAAGAGCTGGGGCAAAATT
JMSF038J04- TCTATGATTCTTGACACTTCCAATGCGCCATTGAAGCAATTAAAGAGCTGGGGCAAAATT
                      ____________________________________________________________
consensus TCTATGATTCTTGACACTTCCAATGCGCCATTGAAGCAATTAAAGAGCTGGGGCAAAATT
 
. : . : . : . : . : . :
JMSF012A22- TCTTATATCGGCTTGAAGAAGCGCGACAGAAGAAGTCATAATCGCTACCCTGCAGGGAAA
JMSF049A14- TCTTATATCGGCTTGAAGAAGCGCGACAGAAGAAGTCATAATCGCTACCCTGCAGGGAAA
JMSF029G15- TCTTATATCGGCTTGAAGAAGCGCGACAGAAGAAGTCATAATCGCTACCCTGCAGGGAAA
JMSF038J04- TCTTATATCGGCTTGAAGAAGCGCGACAGAAGAAGTCATAATCGCTACCCTGCAGGGAAA
                      ____________________________________________________________
consensus TCTTATATCGGCTTGAAGAAGCGCGACAGAAGAAGTCATAATCGCTACCCTGCAGGGAAA
 
. : . : . : . : . : . :
JMSF012A22- GTTTGTGCCTATTACGGCCTCAAAGCACCTCCGTTTGAACTTGATGCATTAGAGCCATAC
JMSF049A14- GTTTGTGCCTATTACGGCCTCAAAGCACCTCCGTTTGAACTTGATGCATTAGAGCCATAC
JMSF029G15- GTTTGTGCCTATTACGGCCTCAAAGCACCTCCGTTTGAACTTGATGCATTAGAGCCATAC
JMSF038J04- GTTTGTGCCTATTACGGCCTCAAAGCACCTCCGTTTGAACTTGATGCATTAGAGCCATAC
rJMSF038J04+ CTTGATGCATTAGAGCCATAC
                      ____________________________________________________________
consensus GTTTGTGCCTATTACGGCCTCAAAGCACCTCCGTTTGAACTTGATGCATTAGAGCCATAC
 
. : . : . : . : . : . :
JMSF012A22- ATGAGCCGAAGGACACTAGAGATACACTGGGGTGGGCACCATCGTAGTTATGTGGATGCC
JMSF049A14- ATGAGCCGAAGGACACTAGAGATACACTGGGGTGGGCACCATCGTAGTTATGTGGATGCC
JMSF029G15- ATGAGCCGAAGGACACTAGAGATACACTGGGGTGGGCACCATCGTAGTTATGTGGATGCC
JMSF038J04- ATGAGCCGAAGGACACTAGAGATACACTGGGGTGGGCACCATCGTAGTTATGTGGATGCC
rJMSF012A22+ ATCGTAGTTATGTGGATGCC
rJMSF038J04+ ATGAGCCGAAGGACACTAGAGATACACTGGGGTGGGCACCATCGTAGTTATGTGGATGCC
rJMSF029G15+ TAGAGATACACT-GGGTGGGCACCATCGTAGTTATGTGGATGCC
                      ____________________________________________________________
consensus ATGAGCCGAAGGACACTAGAGATACACTGGGGTGGGCACCATCGTAGTTATGTGGATGCC
 
. : . : . : . : . : . :
JMSF012A22- CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGA-TTCACCATGGAAGAACT
JMSF049A14- CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGA-TTCACCATGGAAGAACTTAT
JMSF029G15- CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGA-TTCACCATGGAAGAACTTAT
JMSF038J04- CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGA-TTCACCATGGAAGAACTTAT
rJMSF012A22+ CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGA-TTCACCATGGAAGAACTTAT
rJMSF049A14+ AGAAGAATGATTTACTGTATGGANTTCCCCATGGAAGAACTTAT
rJMSF038J04+ CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGA-TTCACCATGGAAGAACTTAT
rJMSF029G15+ CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGATTTCACCATGGAAGAACTTAT
                      ____________________________________________________________
consensus CTTAACAAACAGCTTGAGAAGAATGATTTACTGTATGGA-TTCACCATGGAAGAACTTAT
 
. : . : . : . : . : . :
JMSF049A14- TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
JMSF029G15- TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
JMSF038J04- TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
rJMSF012A22+ TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
rJMSF049A14+ TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
rJMSF038J04+ TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
rJMSF029G15+ TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
                      ____________________________________________________________
consensus TAGAGTGACCTATAACAATGGTAATCCATTACCTGAATTCAACAATGCTGCTCAGGTATG
 
. : . : . : . : . : . :
JMSF049A14- GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
JMSF029G15- GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
JMSF038J04- GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
rJMSF012A22+ GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
rJMSF049A14+ GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
rJMSF038J04+ GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
rJMSF029G15+ GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
                      ____________________________________________________________
consensus GAATCATGATTTCTTTTGGGAATCCATGCAACCTGGAGGAGGGGACATGCCTACATTGAG
 
. : . : . : . : . : . :
JMSF049A14- CCTACTAAAGCAGATTGAAAAGGATTTTGGCTCATTCACAAATTTCAGAGAGAAGTTCGT
JMSF029G15- CCTACTAAAGCAGAT
JMSF038J04- CCTACTAAAGCAGATTGAAAAGGATTTTGGCTCATTCACAAATTTCAGAGAGAAGTTCGT
rJMSF012A22+ CCTACTAAAGCAGATTGAAAAGGATTTTGGCTCATTCACAAATTTCAGAGAGAAGTTCGT
rJMSF049A14+ CCTACTAAAGCAGATTGAAAAGGATTTTGGCTCATTCACAAATTTCAGAGAGAAGTTCGT
rJMSF038J04+ CCTACTAAAGCAGATTGAAAAGGATTTTGGCTCATTCACAAATTTCAGAGAGAAGTTCGT
rJMSF029G15+ CCTACTAAAGCAGATTGAAAAGGATTTTGGCTCATTCACAAATTTCAGAGAGAAGTTCGT
                      ____________________________________________________________
consensus CCTACTAAAGCAGATTGAAAAGGATTTTGGCTCATTCACAAATTTCAGAGAGAAGTTCGT
 
. : . : . : . : . : . :
JMSF049A14- AGAAGTAGCCCTCACATCATTTGGCTCTGGTTGGGTTTGGCTTGNTTTGAAGAGT
JMSF038J04- AGAAGTAGCCCTCACATCATTTGGCTCTGGTTGGGTTTGGCTTGTTTTGAAGAGTGAGGA
rJMSF012A22+ AGAAGTAGCCCTCACATCATTTGGCTCTGGTTGGGTTTGGCTTGTTTTGAAGAGTGAGGA
rJMSF049A14+ AGAAGTAGCCCTCACATCATTTGGCTCTGGTTGGGTTTGGCTTGTTTTGAAGAGTGAGGA
rJMSF038J04+ AGAAGTAGCCCTCACATCATTTGGCTCTGGTTGGGTTTGGCTTGTTTTGAAGAGTGAGGA
rJMSF029G15+ AGAAGTAGCCCTCACATCATTTGGCTCTGGTTGGGTTTGGCTTGTTTTGAAGAGTGAGGA
                      ____________________________________________________________
consensus AGAAGTAGCCCTCACATCATTTGGCTCTGGTTGGGTTTGGCTTGTTTTGAAGAGTGAGGA
 
. : . : . : . : . : . :
JMSF038J04- GAAACGTCTTGCTGT
rJMSF012A22+ GAAACGTCTTGCTGTTGTTAGAACATCAAATGCTGTCAACCCTCTTTTGTGGAATGACAT
rJMSF049A14+ GAAACGTCTTGCTGTTGTTAGAACATCAAATGCTGTCAACCCTCTTTTGTGGAATGACAT
rJMSF038J04+ GAAACGTCTTGCTGTTGTTAGAACATCAAATGCTGTCAACCCTCTTTTGTGGAATGACAT
rJMSF029G15+ GAAACGTCTTGCTGTTGTTAGAACATCAAATGCTGTCAACCCTCTTTTGTGGAATGACAT
                      ____________________________________________________________
consensus GAAACGTCTTGCTGTTGTTAGAACATCAAATGCTGTCAACCCTCTTTTGTGGAATGACAT
 
. : . : . : . : . : . :
rJMSF012A22+ TCCTCTCATCTGTTTGGATATGTGGGAACACGCTTATTATATTGATTACCAG--------
rJMSF049A14+ TCCTCTCATCTGTTTGGATATGTGGGAACACGCTTATTATATTGATTACCAGGTAACAAC
rJMSF038J04+ TCCTCTCATCTGTTTGGATATGTGGGAACACGCTTATTATATTGATTACCAG--------
rJMSF029G15+ TCCTCTCATCTGTTTGGATATGTGGGAACACGCTTATTATATTGATTACCAG--------
                      ____________________________________________________________
consensus TCCTCTCATCTGTTTGGATATGTGGGAACACGCTTATTATATTGATTACCAG--------
 
. : . : . : . : . : . :
rJMSF012A22+ ------AATGATAAAGCCAAGTATGTTAACATGTTCATGAATCACCTTGTTTCTTGGCAA
rJMSF049A14+ TCACAAAATGATAAAGCCAAGTATGTTAACATGTTCATGAATCACCTTGTTTCTTGGCAA
rJMSF038J04+ ------AATGATAAAGCCAAGTATGTTAACATGTTCATGAATCACCTTGTTTCTTGGCAA
rJMSF029G15+ ------AATGATAAAGCCAAGTATGTTAACATGTTCATGAATCACCTTGTTTCTTGGCAA
                      ____________________________________________________________
consensus ------AATGATAAAGCCAAGTATGTTAACATGTTCATGAATCACCTTGTTTCTTGGCAA
 
. : . : . : . : . : . :
rJMSF012A22+ TCTGCATTGGTACGCATGGCTCGCGCACAGGCATTTGTGAACTTAGGAGAACCCAAAATT
rJMSF049A14+ TCTGCATTGGTACGCATGGCTCGCGCACAGGCATTTGTGAACTTAGGAGAACCCAAAATT
rJMSF038J04+ TCTGCATTGGTACGCATGGCTCGCGCACAGGCATTTGTGAACTTAGGAGAACCCAAAATT
rJMSF029G15+ TCTGCATTGGTACGCATGGCTCGCGCACAGGCATTTGTGAACTTAGGAGAACCCAAAATT
                      ____________________________________________________________
consensus TCTGCATTGGTACGCATGGCTCGCGCACAGGCATTTGTGAACTTAGGAGAACCCAAAATT
 
. : . : . : . : . : . :
rJMSF012A22+ CCTGTTGCATGACACTCCTCCAACTTTATCGGGAAGTAAATGTCATTAAGCAGAAACAGA
rJMSF049A14+ CCTGTTGCATGACACTCCTCCAACTTTATCGGGAAGTAAATGTCATTAAGCAGAAACAGA
rJMSF038J04+ CCTGTTGCATGACACTCCTCCAACTTTATCGGGAAGTAAATGTCATTAAGCAGAAACAGA
rJMSF029G15+ CCTGTTGCATGACACTCCTCCAACTTTATCGGGAAGTAAATGTCATTAAGCAGAAACAGA
                      ____________________________________________________________
consensus CCTGTTGCATGACACTCCTCCAACTTTATCGGGAAGTAAATGTCATTAAGCAGAAACAGA
 
. : . : . : . : . : . :
rJMSF012A22+ AGCAGGTGAATGGATTAAATTCAGCAGAGAAGGACCTAAGCGAAATAGCAGAAGATTGGC
rJMSF049A14+ AGCAGGTGAATGGATTAAATTCAGCAGAGAAGGACCTAAGCGAAATAGCAGAAGATTGGC
rJMSF038J04+ AGCAGGTGAATGGATTAAATTCAGCAGAGAAGGACCTAAGCGAAATAGCAGAAGATTGGC
rJMSF029G15+ AGCAGGTGAATGGATTAAATTCAGCAGAGAAGGACCTAAGCGAAATAGCAGAAGATTGGC
                      ____________________________________________________________
consensus AGCAGGTGAATGGATTAAATTCAGCAGAGAAGGACCTAAGCGAAATAGCAGAAGATTGGC
 
. : . : . : . : . : . :
rJMSF012A22+ AACCAAAGAGAATGGGCGCCAAAATGGCGTTTTTGGATCAAAGAATAAAACCAGCTTTGT
rJMSF049A14+ AACCAAAGAGAATGGGCGCCAAAATGGCGTTTTTGGATCAAAGAATAAAACCAGCTTTGT
rJMSF038J04+ AACCAAAGAGAATGGGCGCCAAAATGGCGTTTTTGGATCAAAGAATAAAACCAGCTTTGT
rJMSF029G15+ AACCAAAGAGAATGGGCGCCAAAATGGCGTTTTTGGATCAAAGAATAAAACCAGCTTTGT
                      ____________________________________________________________
consensus AACCAAAGAGAATGGGCGCCAAAATGGCGTTTTTGGATCAAAGAATAAAACCAGCTTTGT
 
. : . : . : . : . : . :
rJMSF012A22+ CTGCTTGCATAGGACTGACCAGGGATTTGATATTTGAAGTTGTAGGC
rJMSF049A14+ CTGCTTGCATAGGACTGACCAGGGATTTGATATTTGAAGTTGTAGGC
rJMSF038J04+ CTGCTTGCATAGGACTGA-CAGGGATTTGATATTTGAAGTTGTAGGC
rJMSF029G15+ CTGCTTGCATAGGACTGA-CAGGGATTTGATATTTGAAGTTGTAGGCAGTGTTTGGATAT
                      ____________________________________________________________
consensus CTGCTTGCATAGGACTGACCAGGGATTTGATATTTGAAGTTGTAGGCAGTGTTTGGATAT