Previous Contig 012646:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016H03Sequence243006585 (2)gb:AY087050_15720861e-10Arabidopsis thaliana clone 31039 mRNA, complete sequence.767012646 (2)gb:AB007651_15102746e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD9.>gb:AY050804_15623
JMSF029G12Sequence672006585 (2)gb:AB007651_15102741e-28Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD9.>gb:AY050804_15623811012646 (2)gb:AB007651_15102748e-61Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD9.>gb:AY050804_15623

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029G12+ TACGTGATTGGCATGTCGATGGGAGCATATA
                      ____________________________________________________________
consensus TACGTGATTGGCATGTCGATGGGAGCATATA
 
. : . : . : . : . : . :
rJMSF016H03+ TGCCTAAAGTACATACCACACAGGTTGGCTGGAGCTTCACTTGTAGTTCC
rJMSF029G12+ TCATTACAGNTGCCTAAAGTACATACCACACAGGTTGGCTGGAGCTTCACTTGTAGTTCC
                      ____________________________________________________________
consensus TCATTACAGNTGCCTAAAGTACATACCACACAGGTTGGCTGGAGCTTCACTTGTAGTTCC
 
. : . : . : . : . : . :
rJMSF016H03+ GTTTGTCCACTACTGGTGGCCTCATTTTCCCGCTAAAATATCAAAAGAAGCCCTGCAGAA
rJMSF029G12+ GTTTGTCCACTACTGGTGGCCTCATTTTCCCGCTAAAATATCAAAAGAAGCCCTGCAGAA
                      ____________________________________________________________
consensus GTTTGTCCACTACTGGTGGCCTCATTTTCCCGCTAAAATATCAAAAGAAGCCCTGCAGAA
 
. : . : . : . : . : . :
rJMSF016H03+ ACAACTCATACAAGACCAATGGACATTCAAAATGGCGCATTATGCTCCATGGCTGTTCTA
rJMSF029G12+ ACAACTCATACAAGACCAATGGACATTCAAAATGGCGCATTATGCTCCATGGCTGTTCTA
                      ____________________________________________________________
consensus ACAACTCATACAAGACCAATGGACATTCAAAATGGCGCATTATGCTCCATGGCTGTTCTA
 
. : . : . : . : . : . :
rJMSF016H03+ TTGGTGGATGACTCAAAAATGGTTTCCTTCTTTAAGTGCTCTGCAAGGGAACATGGCTAT
rJMSF029G12+ TTGGTGGATGACTCAAAAATGGTTTCCTTCTTTAAGTGCTCTGCAAGGGAACATGGCTAT
                      ____________________________________________________________
consensus TTGGTGGATGACTCAAAAATGGTTTCCTTCTTTAAGTGCTCTGCAAGGGAACATGGCTAT
 
. : . : . : . : . : . :
rJMSF016H03+ TTTCTGCCCCCAAGATCTGGAAACCATAAAGCAGCTAATGGAAGGCCCCCCTAATGACAA
rJMSF029G12+ TTTCTGCCCCCAAGATCTGGAAACCATAAAGCAGCTAATGGAAGGCCCCCCTAATGACAA
                      ____________________________________________________________
consensus TTTCTGCCCCCAAGATCTGGAAACCATAAAGCAGCTAATGGAAGGCCCCCCTAATGACAA
 
. : . : . : . : . : . :
rJMSF016H03+ TCAGGAAAGACTAAGGCAACAGGGTGTTTATGAATCACTATACCGAGACATAATGGTTGG
rJMSF029G12+ TCAGGAAAGACTAAGGCAACAGGGTGTTTATGAATCACTATACCGAGACATAATGGTTGG
                      ____________________________________________________________
consensus TCAGGAAAGACTAAGGCAACAGGGTGTTTATGAATCACTATACCGAGACATAATGGTTGG
 
. : . : . : . : . : . :
rJMSF016H03+ TTATGCAAAATGGGAATTCAGTCCATTGGATTTAATCAATCCATTTCCCAACAATGAGGG
rJMSF029G12+ TTATGCAAAATGGGAATTCAGTCCATTGGATTTAATCAATCCATTTCCCAACAATGAGGG
                      ____________________________________________________________
consensus TTATGCAAAATGGGAATTCAGTCCATTGGATTTAATCAATCCATTTCCCAACAATGAGGG
 
. : . : . : . : . : . :
rJMSF016H03+ CTCTGTCCACATTTGGCAAGGTCAGGAAGATAAAATCATCCCGGCTGTAGCGAATCGCTA
rJMSF029G12+ CTCTGTCCACATTTGGCAAGGTCAGGAAGATAAAATCATCCCGGCTGTAGCGAATCGCTA
                      ____________________________________________________________
consensus CTCTGTCCACATTTGGCAAGGTCAGGAAGATAAAATCATCCCGGCTGTAGCGAATCGCTA
 
. : . : . : . : . : . :
rJMSF016H03+ TATATCCGAGCAACTCCCCTGGATTCAGTACCACGAGGTTCCAGACGGAGGGCATTTGAT
rJMSF029G12+ TATATCCGAGCAACTCCCCTGGATTCAGTACCACGAGGTTCCAGACGGAGGGCATTTGAT
                      ____________________________________________________________
consensus TATATCCGAGCAACTCCCCTGGATTCAGTACCACGAGGTTCCAGACGGAGGGCATTTGAT
 
. : . : . : . : . : . :
rJMSF016H03+ TATTTTCAACGCGAGTGTATGCGAAACCATCTTCAGGAAATTAGTAGGTGCATGAGATGG
rJMSF029G12+ TATTTTCAACGCGAGTGTATGCGAAACCATCTTCAGGAAATTAGTAGGTGCATGAGATGG
                      ____________________________________________________________
consensus TATTTTCAACGCGAGTGTATGCGAAACCATCTTCAGGAAATTAGTAGGTGCATGAGATGG
 
. : . : . : . : . : . :
rJMSF016H03+ GTGTATAGCTGACATGTGAGGAATACAAAGTTGAAAATAAAGACCCCAGTGGGGATTGAG
rJMSF029G12+ GTGTATAGCTGACATGTGAGGAATACAAAGTTGAAAATAAAGACCCCAGTGGGGATTGAG
                      ____________________________________________________________
consensus GTGTATAGCTGACATGTGAGGAATACAAAGTTGAAAATAAAGACCCCAGTGGGGATTGAG
 
. : . : . : . : . : . :
rJMSF016H03+ GATGAAAAGATTGACCTCAGTTGTAAAAGCTATGTACTCTGTTTACAAGTATTGTTATCT
rJMSF029G12+ GATGAAAAGATTGACCTCAGTTGTAAAAGCTATGTACTCTGTTTACAAGTATTGTTATCT
                      ____________________________________________________________
consensus GATGAAAAGATTGACCTCAGTTGTAAAAGCTATGTACTCTGTTTACAAGTATTGTTATCT
 
. : . : . : . : . : . :
rJMSF016H03+ AATGTTAATGCTGGTATTGGTGAATACATTAAAATGAACAAGTTCATGTAATG
rJMSF029G12+ AATGTTAATGCTGGTATTGGTGAATACATTAAAATGAACAAGTTCATGTAATGGAAGGGC
                      ____________________________________________________________
consensus AATGTTAATGCTGGTATTGGTGAATACATTAAAATGAACAAGTTCATGTAATGGAAGGGC